Tag: enzymes work by

Three Novel Entomopathogenic Fungi From China and Thailand

Entomopathogenic fungi are ubiquitous in tropical rainforests and function a excessive stage of range. This group of fungi not solely has necessary ecological worth but in addition medicinal worth. Nevertheless, they’re typically ignored, and many unknown species have but to be found and described. The current examine goals to contribute to the taxonomical and phylogenetic understanding of the genus Paraisaria by describing three new species collected from Guizhou and Yunnan Provinces in China and Krabi Province in Thailand.
The three novel species named Paraisaria alba, P. arcta, and P. rosea share comparable morphologies as these within the genus Paraisaria, containing solitary, easy, fleshy stroma, fully immersed perithecia and cylindrical asci with thickened caps and filiform ascospores that usually disarticulate at maturity. Phylogenetic analyses of mixed LSU, SSU, TEF1-α, RPB1, RPB2, and ITS sequence knowledge verify their placement within the genus Paraisaria. In this examine, the three entomopathogenic taxa are comprehensively described with colour images and phylogenetic analyses. A synopsis desk and a key to all handled species of Paraisaria are additionally included.

First report of alfalfa leaf spot brought on by Leptosphaerulina australis in China

A illness was noticed on alfalfa cultivar WL168 characterised by white to brown leaf spots of normal to spherical shapes, in Aluhorqin County, Inner Mongolia, China (120°13’23″ to 120°29’14″ E, 43°27’52″to 43°35’16″ N, 281.71m to360.13 m Altitude) throughout 2019 to 2020. The illness primarily offered in spring one month after re-greening and the incidence was 78.30% on this discipline.
Twenty alfalfa vegetation with extreme signs had been used for pathogen isolation. The contaminated tissue was reduce into 2 × 2 mm items, surface-sterilized (in 75% ethanol and 5% business bleach (NaClO) for 30 s and 2 min, respectively), rinsed 5 occasions with sterilized distilled water, and dried between sterile filter paper (Wang et al. 2019). The diseased tissue from every plant pattern had been cultured on potato dextrose agar (PDA) and incubated at 25 °C with 12 h mild/day for ten days.
A fungus was remoted from the diseased leaves at a 100% frequency. Fungal development on PDA was spherical with a black floor, radial edge, and a unclean white middle. The ascocarps had been moved to a clear microscope slide to launch asci and ascospores. Ascocarps had been spheroidal, subglobose brown, 120 to 160 µm × 160 to 180 µm, which include a number of ascus. The dimension of ascus had been 31.zero to 41.6 μm × 75.zero to 87.5 μm and every asci having eight ascospores.
Ascospores had been ellipsoid to rectangular with a gelatinous sheath, brown, 8.Eight to 15.zero µm × 29.9 to 43.zero µm with 2 to three horizontal septums, and zero to 2 vertical septums. A phylogenetic tree was constructed after DNA extraction, PCR with primers to amplify the ITS (VG9: 5′- TTACGTCCCTGCCCTTTGTA-3′ and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′) and LSU (LR7: 5′-TACTACCACCAAGATCT-3′ and LROR: 5′- GTACCCGCTGA ACTTAAGC -3′) areas. The LSU (SUB8273071) and ITS (SUB8218291) amplicons confirmed 99% similarity with L. australis (EU754166.1) within the GenBank.
To confirm the pathogenicity, fungs plugs had been inverted on three compound leaves of 20 alfalfa WL168 for 2 days. Agar plugs (PDA) had been inverted on one other 20 alfalfa WL168 three compound leaves which had been management. All vegetation had been maintained at 22 °C and 44% relative humidity in a development chamber. Similar illness signs had been noticed on contaminated leaves ten days after inoculation, whereas management vegetation confirmed no signs.
The similar fungus was re-isolated from the lesions, and additional morphological characterization and molecular assays, as described above. L. australis has been reported on numerous vegetation, together with Prunusarmeniaca, Dolichos, Poa, Lolium, and Vitis in Australia (Graham and Luttrell., 1961), and additionally from Korean soil in 2018 (Weilan et al., 2018). Additionally, L. briosiana, which is frequent within the USA, China, and different nations, causes Leptosphaerulina leaf spot (Samacet al., 2015). L. trifolii is newly reported to happen in China (Liu et al., 2019). To one of the best of our information, that is the primary report of L. australis infecting alfalfa in China. Considering the big planting space in Inner Mongolia, this pathogen might losses to alfalfa cultivation. Hence, future research ought to discover points of efficient administration of this illness.

Four new species of Talaromyces part Talaromyces found in China

Four new Talaromyces species with none shut kinfolk are reported right here, specifically, T. aureolinus (ex-type AS3.15865 T), T. bannicus (ex-type AS3.15862 T), T. penicillioides (ex-type AS3.15822 T), and T. sparsus (ex-type AS3.16003 T). Morphologically, T. aureolinus is exclusive in producing orange-yellow mycelium and gymnothecia, singly borne asci, and ellipsoidal, spiny ascospores.
Three Novel Entomopathogenic Fungi From China and Thailand
 Talaromyces bannicus is characterised by the sluggish development price, polymorphic conidiophores, inconsistent stipe lengths, and pyriform to ellipsoidal, echinulate conidia. Talaromyces penicillioides is distinguished by good development and sporulation on malt extract agar (MEA) and yeast extract sucrose agar (YES) media, resembling the colony appearances of sure Penicillium species, and appressed biverticillate and sometimes monoverticillate penicilli bearing globose to ellipsoidal, echinulate conidia.

FSCN1 antibody
70R-17358 50 ul
EUR 435
Description: Rabbit polyclonal FSCN1 antibody

FSCN1 Antibody
DF7988 200ul
EUR 304
Description: FSCN1 Antibody detects endogenous levels of total FSCN1.

FSCN1 Antibody
1-CSB-PA005142
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

FSCN1 Antibody
1-CSB-PA619084LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FSCN1 Antibody
1-CSB-PA009010GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FSCN1 Antibody
1-CSB-PA182867
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

FSCN1 Antibody
1-CSB-PA203862
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

FSCN1 Conjugated Antibody
C35636 100ul
EUR 397

Fascin (FSCN1) Antibody
20-abx126914
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Fascin (Fscn1) Antibody
20-abx112474
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
20-abx141208
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
abx032965-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
abx032965-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
20-abx006708
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
20-abx327559
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
20-abx214267
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
20-abx338423
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
abx432714-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fascin (FSCN1) Antibody
20-abx241222
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody
abx233018-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

FSCN1 Monoclonal Antibody
A1062-50
EUR 300

Anti-FSCN1 antibody
STJ71472 100 µg
EUR 359

Anti-FSCN1 antibody
STJ23712 100 µl
EUR 413
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody
STJ27695 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody
STJ115318 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Fscn1/ Rat Fscn1 ELISA Kit
ELI-05701r 96 Tests
EUR 886

FSCN1 siRNA
20-abx902015
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 siRNA
20-abx917244
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 siRNA
20-abx917245
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 Polyclonal Conjugated Antibody
C30401 100ul
EUR 397

Fascin (FSCN1) Antibody (HRP)
20-abx335658
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (FITC)
20-abx335659
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (Biotin)
20-abx335660
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FSCN1 Antibody, HRP conjugated
1-CSB-PA619084LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FSCN1 Antibody, FITC conjugated
1-CSB-PA619084LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FSCN1 Antibody, Biotin conjugated
1-CSB-PA619084LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Fascin/FSCN1 Antibody
PB9592 100ug/vial
EUR 294

Anti-Fascin/FSCN1 Antibody
PA1575 100ug/vial
EUR 294

FSCN1 Rabbit pAb
A5867-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb
A5867-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb
A5867-20ul 20 ul Ask for price

FSCN1 Rabbit pAb
A5867-50ul 50 ul Ask for price

FSCN1 Rabbit pAb
A13355-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb
A13355-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb
A13355-20ul 20 ul
EUR 183

FSCN1 Rabbit pAb
A13355-50ul 50 ul
EUR 223

Fscn1 Blocking Peptide
33R-9865 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fscn1 antibody, catalog no. 70R-8641

FSCN1 Blocking Peptide
DF7988-BP 1mg
EUR 195

FSCN1 cloning plasmid
CSB-CL619084HU-10ug 10ug
EUR 524
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atgaccgccaacggcacagccgaggcggtgcagatccagttcggcctcatcaactgcggcaacaagtacctgacggccgaggcgttcgggttcaaggtgaacgcgtccgccagcagcctgaagaagaagcagatctggacgctggagcagccccctgacgaggcgggcagcgcgg
  • Show more
Description: A cloning plasmid for the FSCN1 gene.

Polyclonal FSCN1 Antibody (internal region)
APR16037G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FSCN1 (internal region). This antibody is tested and proven to work in the following applications:

Fascin-1(FSCN1/416) Antibody
BNC610416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC610416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC610417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC610417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC610418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC610418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC680416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC680416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC680417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC680417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC680418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC680418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC400416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC400416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC400417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC400417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC400418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC400418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC430416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC430416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC430417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC430417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC430418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC430418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC550416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC550416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC550417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC550417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC550418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC550418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC040416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC040416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC040417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC040417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC040418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC040418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC050416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC050416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC050417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC050417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC050418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC050418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC470416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC470416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC470417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC470417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC470418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC470418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNUM0416-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/416), 1mg/mL

Fascin-1(FSCN1/417) Antibody
BNUM0417-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/417), 1mg/mL

Fascin-1(FSCN1/418) Antibody
BNUM0418-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/418), 1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC700416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC700416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC700417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC700417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC700418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC700418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC940416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNC940416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC940417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNC940417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC940418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody
BNC940418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNCH0416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody
BNCH0416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody
BNCH0417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
 Talaromyces sparsus has extensive, submerged colony margins with sparse aerial mycelium, and conidial areas overlaid with yellow-green, sterile hyphae on MEA medium. These 4 new species are effectively supported by particular person phylogenetic timber based mostly on β-tubulin (BENA), calmodulin (CALM), DNA-dependent RNA polymerase II second largest subunit (RPB2), and inside transcribed spacer area (ITS) gene sequences and the tree of the concatenated BENA-CALM-RPB2 sequence.