Mycosphaerangium and Neomelanconium (Cenangiaceae) are closest relatives: phylogenetic relationships, morphology and a new species

Based on molecular phylogenetic analyses of a multigene matrix of partial nuSSU-ITS-LSU rDNA, RPB1RPB2 and TEF1 sequences and by morphological proof, the genus Mycosphaerangium is proven to be the closest relative of Neomelanconium, and confirmed to be a member of the Cenangiaceae (Leotiomycetes). While Mycosphaerangium and Neomelanconium share many traits like comparable conidia, conidiogenesis, asci and ascospores, their apothecia differ notably in excipular options and are subsequently acknowledged as distinct genera.
Mycosphaerangium tiliae, described from North America, is excluded from the genus however proven to characterize the sexual morph of the European Neomelanconium gelatosporum, and it’s subsequently synonymized with the latter. Based on morphology, Neomelanconium deightonii is assumed to be congeneric with Neomelanconium gelatosporum, and it’s lectotypified.
Dermatea tetraspora and Phaeangium magnisporum, the basionyms of Mycosphaerangium tetrasporum and M. magnisporum, respectively, are lectotypified as effectively, and for M. tetrasporum, the asexual morph is recorded for the primary time. Mycosphaerangium quercinum sp. nov. is described as a new species from numerous Quercus hosts in Europe, the place it’s proven to be extensively distributed.
It morphologically and ecologically carefully resembles the North American M. tetrasporum, however differs in paraphysis and ascospore morphology and by croziers at its ascus base. The three accepted species of Mycosphaerangium and the 2 of Neomelanconium are described and illustrated. Mycosphaerangium magnisporumM. quercinum and M. tetrasporum are recorded to be consistently related to species of Coryneum, indicating a fungicolous behavior, however no proof for fungal associations has been present in Neomelanconium deightonii and N. gelatosporum.

First report of seedling blight of maize brought on by Fusarium asiaticum in Northeast China

Maize [Zea mays L.] is a vital meals and feed crops in northeast of China. In 2019, maize seedling blight with an incidence of as much as 25% was discovered on the subject in Fushun metropolis of Liaoning Province. Typical signs of seedlings have been yellow, skinny, wilt and die. The leaves steadily turned yellow from the bottom of the plant to the highest. Root system was poorly developed.
The major roots have been normally discolored and rotted. And faintly pink or puce-coloured mould was discovered on seeds of the rotted seedings. Symptomatic roots of diseased seedling have been collected and surface-disinfested with 70% ethanol for 1 min and then in 2% NaClO for Three min, rinsed with sterilized water thrice, lower into small items and positioned on potato dextrose agar (PDA) medium for five days at 25 °C. Colonies on PDA have been pink to darkish purple with fluffy aerial mycelium and purple to aubergine pigmentation with the age.
The causal agent was transferred to carnation leaf agar (CLA) medium and incubated at 25°C below a 12-h light-dark cycle. 12 Pure cultures have been obtained from single conidia with an inoculation needle below stereomicroscope. The harvested macroconidia have been hyaline, falcate with single foot cells, 3-5 septate and 28.2- 43.5 μm × 3.7 – 4.9 μm. Chlamydospores have been globose to subglobose (5 to 13.5 μm).
No microconidia have been discovered. The perithecia have been black, ostiolate subglobose. Asci have been hyaline, clavate, measuring 58.1- 83.9 µm × 7.7- 11.9 µm and contained eight ascospores. Morphological characters of the pathogen agreed effectively with descriptions of Fusarium asiaticum (O’Donnell et al.2004; Leslie and Summerell 2006). To verify the identification, partial translation elongation issue 1 alpha (TEF1-a) gene and rDNA inside transcribed spacer (ITS) area of isolate MSBL-Four have been amplified and sequenced (O’Donnell et al. 2015; White et al.1990).
BLASTn evaluation of each TEF sequence (MT330257) and ITS sequence (MT322117), revealed 100% sequence identification with F. asiaticum KT380116 and KX527878, respectively. The isolate MSBL-Four was NIV chemotype as decided by Tri13F/DON, Tri13NIV/R (Chandler et al, 2003) assays. Pathogenicity research have been carried out on maize hybrid “Liaodan 565”. Inoculum of F. asiaticum was ready from the tradition of MSBL-Four incubate in 2% mung beans juice on a shaker (150 rpm) at 25°C for 48 hours.
The 5 liter pots (10 pots) have been crammed with sterilized subject soil and 5 of them have been blended with conidial suspension (300mL in every pot) at 2 × 105 conidia per ml. Ten kernels per pot have been floor disinfected in 2% sodium hypochlorite for five min, rinsed with sterilized water and planted. Five pots have been inoculated and one other uninoculated 5 pots served as controls. The pots have been maintained in a greenhouse at 22-26°C for 40 days. Leaves of the vegetation in inoculated pots have been yellowing and the roots turned discolored or necrotic rot at Four weeks after seedling emergence.
Mycosphaerangium and Neomelanconium (Cenangiaceae) are closest relatives: phylogenetic relationships, morphology and a new species
All traits of the illness have been just like these noticed in subject. Non-inoculated management vegetation had no signs. Fusarium asiaticum was reisolated from inoculated vegetation and was an identical to the unique isolate. The experiment was repeated as soon as with comparable outcomes. To our information, that is the primary report of seedling blight brought on by F. asiaticum on maize in northeast China, and it has posed a risk to maize manufacturing of China. References: Leslie J F and Summerell BA. 2006. The Fusarium laboratory guide. Blackwell Publishing, Ames, pp 176-179. O’Donnell et al.2004. Fungal Genetics and Biology 41: 600-623. O’ Donnell et al. 2015. Phytoparasitica 43:583-595. White T J et al. 1990. Academic Press, San Diego, CA, pp 315-322. Chandler E A et al. 2003. Physiological and Molecular Plant Pathology 62(6): 355-367.

Benchmarking an Embedded Adaptive Sampling Configuration Interaction Method for Surface Reactions: H 2 Desorption from and CH 4 Dissociation on Cu(111)

Embedded (emb-) correlated wavefunction (CW) principle allows correct assessments of each ground- and excited-state response mechanisms concerned in heterogeneous catalysis. Embedded multireference second-order perturbation principle (emb-MRPT2) based mostly on reference wavefunctions generated through embedded full energetic house self-consistent subject (emb-CASSCF) principle is at the moment state-of-the-art. However, the factorial scaling of CASSCF limits the dimensions of energetic house and the complexity of programs that may be studied. Here, we assess the efficacy of an alternate CW technique, adaptive sampling configuration interplay (ASCI)-which allows massive energetic areas to be used-for learning floor reactions.
We couple ASCI with density practical embedding principle (DFET) and benchmark its efficiency for 2 reactions: H2 desorption from and CH4 dissociation on the Cu(111) floor. Unlike embedded full energetic house second-order perturbation principle (emb-CASPT2) that precisely reproduces a measured H2 desorption barrier, embedded ASCI, utilizing a very massive energetic house (although one that also contains a small portion of the complete set of orbitals) fails to take action.
Adding an additional correlation time period from embedded Møller-Plesset second-order perturbation principle (emb-MP2) improves the desorption barrier and endothermicity predictions. Thus, the inaccuracy of embedded ASCI comes from the lacking dynamic correlation from the various different electrons and orbitals not included within the energetic house.
For CH4 dissociation, once more embedded ASCI overestimates the dissociation barrier in comparison with emb-CASPT2 predictions. Adding dynamic correlation from emb-MP2 helps appropriate the barrier. However, this composite method suffers from double counting of correlation inside embedded ASCI adopted by emb-MP2 calculations.

Anti-human CD11b Monoclonal Antibody PE Conjugated, Flow Validated

FC00144-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD11b Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD19 Monoclonal Antibody PE Conjugated, Flow Validated

FC00154-PE 25 Tests, 100 Tests, 200 Tests
EUR 108
Description: Mouse Monoclonal human CD19 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD54 Monoclonal Antibody PE Conjugated, Flow Validated

FC00171-PE 25 Tests, 100 Tests, 200 Tests
EUR 142
Description: Anti-Human CD54 Monoclonal Antibody PE Conjugated, Flow Validated

Anti-human CD38 Monoclonal Antibody PE Conjugated, Flow Validated

FC00193-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD38 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD25 Monoclonal Antibody PE Conjugated, Flow Validated

FC00214-PE 25 Tests, 100 Tests, 200 Tests
EUR 125
Description: Mouse Monoclonal human CD25 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD86 Monoclonal Antibody PE Conjugated, Flow Validated

FC00220-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Human CD86 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD4 Monoclonal Antibody PE Conjugated, Flow Validated

FC00344-PE 25 Tests, 100 Tests, 200 Tests
EUR 113
Description: Mouse Monoclonal human CD4 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD11c Monoclonal Antibody PE Conjugated, Flow Validated

FC00357-PE 25 Tests
EUR 136
Description: Mouse Monoclonal Human CD11c Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD5 Monoclonal Antibody PE Conjugated, Flow Validated

FC00480-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Anti-human CD5 PE Conjugated, designed for Flow Cytometry and validated by Flow Cytometry using Human cells.

Anti-human CD45 Monoclonal Antibody PE Conjugated, Flow Validated

FC00555-PE 25 Tests, 100 Tests, 200 Tests
EUR 118
Description: Mouse Monoclonal human CD45 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD2 Monoclonal Antibody PE Conjugated, Flow Validated

FC00570-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD2 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD71 Monoclonal Antibody PE Conjugated, Flow Validated

FC00591-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD71 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD62L Monoclonal Antibody PE Conjugated, Flow Validated

FC00652-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD62L Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD59 Monoclonal Antibody PE Conjugated, Flow Validated

FC00914-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD59 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD81 Monoclonal Antibody PE Conjugated, Flow Validated

FC01281-PE 25 Tests, 100 Tests, 200 Tests
EUR 142
Description: Mouse Monoclonal Human CD81 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD117 Monoclonal Antibody PE Conjugated, Flow Validated

FC01335-PE 25 Tests, 100 Tests, 200 Tests
EUR 143
Description: Mouse Monoclonal human CD117 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD16 Monoclonal Antibody PE Conjugated, Flow Validated

FC01408-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD16 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD32 Monoclonal Antibody PE Conjugated, Flow Validated

FC01450-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD32 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD90 Monoclonal Antibody PE Conjugated, Flow Validated

FC01818-PE 25 Tests, 100 Tests, 200 Tests
EUR 183
Description: Mouse Monoclonal human CD90 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD7 Monoclonal Antibody PE Conjugated, Flow Validated

FC01974-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD7 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD235a Monoclonal Antibody PE Conjugated, Flow Validated

FC02184-PE 25µg, 100µg
EUR 165
Description: Mouse Monoclonal human CD235a Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD8 Monoclonal Antibody PE Conjugated, Flow Validated

FC02236-PE 25 Tests, 100 Tests, 200 Tests
EUR 114
Description: Mouse Monoclonal human CD8 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD13 Monoclonal Antibody PE Conjugated, Flow Validated

FC02591-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD13 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD3 Monoclonal Antibody PE Conjugated, Flow Validated

FC02675-PE 25 Tests, 100 Tests, 200 Tests
EUR 110
Description: Mouse Monoclonal human CD3 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD20 Monoclonal Antibody PE Conjugated, Flow Validated

FC03780-PE 25 Tests, 100 Tests, 200 Tests
EUR 149
Description: Mouse Monoclonal human CD20 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD10 Monoclonal Antibody PE Conjugated, Flow Validated

FC04065-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD10 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD57 Monoclonal Antibody PE Conjugated, Flow Validated

FC09548-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD57 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human HLA-DR Monoclonal Antibody PE Conjugated, Flow Validated

FC00568-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human HLA-DR Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD55/Daf Monoclonal Antibody PE Conjugated, Flow Validated

FC00910-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD55/Daf Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human HLA-ABC Monoclonal Antibody PE Conjugated, Flow Validated

FC20056-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Human HLA-ABC Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Mouse TER-119 Monoclonal Antibody PE Conjugated, Flow Validated

FC30403-PE 25ug, 100ug
EUR 120
Description: Rat Monoclonal Mouse TER-119 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Anti-human CD33/Siglec 3 Monoclonal Antibody PE Conjugated, Flow Validated

FC01508-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD33/Siglec 3 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD3 Monoclonal Antibody PE Conjugated, Flow Validated

FC02675-PE-1 25 Tests, 100 Tests, 200 Tests
EUR 78
Description: Mouse Monoclonal Human CD3 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD3 Monoclonal Antibody PE Conjugated, Flow Validated

FC04405-4-PE 25 tests, 100 tests, 500 tests
EUR 114
Description: Mouse Monoclonal Human CD3 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Mouse CD4 Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC00344-PE-Cy7 25ug, 100ug
EUR 137
Description: Rat Monoclonal Mouse CD4 Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Anti-Human CD62L Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC00652-PE-Cy7 25tests, 100tests, 200tests
EUR 188
Description: Mouse Monoclonal Human CD62L Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD33 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC01508-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 195
Description: Mouse Monoclonal Human CD33 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Mouse Anti-human CD7 Monoclonal Antibody PE Conjugated, Flow Validated

FC01974-1-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Mouse human CD7 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD3 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC02675-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 160
Description: Mouse Monoclonal Human CD3 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD10 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC04065-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 166
Description: Mouse Monoclonal human CD10 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human/Mouse CD45R (B220) Monoclonal Antibody PE Conjugated, Flow Validated

FC00555-2-PE 25ug, 100ug
EUR 96
Description: Rat Monoclonal Human/Mouse CD45R (B220) Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human, Mouse.

Anti-Human HLA-DR Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC01340-PE-Cy7 25tests, 100tests, 200tests
EUR 188
Description: Anti-Human HLA-DR Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

Mouse IgG-PE conjugate (isotype control)

20008-PE 50 Tests
EUR 164

Rabbit IgG-PE conjugate (isotype control)

20009-PE 100 tests
EUR 225

Goat IgG-PE conjugate (isotype control)

20011-PE 100 tests
EUR 225

Monoclonal Anti-Rat IgG1-PE Conjugate

50126-PE 0.1 ml
EUR 347

Anti-Mouse CD4 Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC00344-2-PE-Cy7 25ug, 100ug
EUR 131
Description: Rat Monoclonal Mouse CD4 Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Rat IgG-PE conjugate (isotype control) (Isotype control)

20005-PE 25 tests
EUR 202

Mouse Monoclonal Anti-Human IgG1 (Fc-region)-PE (phycoerythrin) conjugate

10121-PE 0.5 ml
EUR 408

Mouse Monoclonal Anti-Human IgG2 (Fc-region)-PE (phycoerythrin) conjugate

10122-PE 0.5 ml
EUR 408

Mouse Monoclonal Anti-Human IgG3 (Hinge-region)-PE (phycoerythrin) conjugate

10123-PE 0.5 ml
EUR 408

Mouse Monoclonal Anti-Human IgG4 (Fc-region)-PE (phycoerythrin) conjugate

10124-PE 0.5 ml
EUR 408

Mouse Monoclonal Anti-Human CD59, (PE) (Clone 1F5) (mouse IgG1)

CD59-PE 25 tests
EUR 408

Rat Monoclonal Anti-Mouse CD25 , PE (Clone PC61.5.3) (rat IgG1)

MCD025-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD34, PE (Clone MEC14.7) (rat IgG2a)

MCD034-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD44, PE (Clone KM81) (rat IgG2a)

MCD044-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD45RB, PE (Clone 16A) (rat IgG2a)

MCD045RB-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD117 , PE (Clone ACK4) (rat IgG2a)

MCD117-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD147, PE (Clone OX114) (rat IgG1)

MCD147-PE 50 tests
EUR 347

Rat Monoclonal Anti-Mouse CD157, PE (Clone KT157) (Rat IgG2c)

MCD157-PE 50 tests
EUR 347

Rat Monoclonal Anti-Mouse CD200, PE (Clone OX90) (rat IgG2a)

MCD200-PE 50 tests
EUR 347

Rat Monoclonal Anti-Mouse CD200R, PE (Clone OX110) (rat IgG2a)

MCD200R-PE 50 tests
EUR 347

Mouse Monoclonal Anti-Rat CD8b PE (Clone 3.4.1 ) (mouse IgG1 )

RCD008B-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD134, PE (Clone OX40) (mouse IgG2b)

RCD134-PE 100 tests
EUR 469

Hamster Mono Anti-Mouse CD3z, PE (Clone H146-968) (hamster IgG)

MCD003Z-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD4 PE (Clone CT-CD4) (rat IgG2a)

MCD004-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Mouse CD11a, PE (Clone 8-6.2) (mouse IgG2a)

MCD011A-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD11b, PE (Clone M1/70.15) (rat IgG2b)

MCD011B-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD40, PE (Clone 3/23) (rat IgG2b)

MCD040-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD45RC, PE (Clone IBL-8) (rat IgG1)

MCD045RC-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD49d, PE (Clone R1-2) (rat IgG2b)

MCD049D-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD62L, PE (Clone MEL-14) (rat IgG2a)

MCD062L-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Mouse CD72.1, PE (Clone CT-72.1) (mouse IgG2a)

MCD072-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD80 , PE (Clone RMMP-1) (rat IgG2a)

MCD080-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Mouse/Rat CD81, PE (Clone Eat2)(mouse IgG1)

MCD081-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD86, PE (Clone RMMP-2) (rat IgG2a)

MCD086-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD90, PE (Clone IBL-1) (rat IgG1)

MCD0902-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD94, PE, (clone: 15F.18D1), (rat IgG1k)

MCD094-PE 50 tests
EUR 347

Rat Monoclonal Anti-Mouse CD134, PE (Clone OX-86)(rat IgG1)

MCD134-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD134L/OX40L, PE (Clone OX89) (rat IgG1)

MCD134L-PE 50 tests
EUR 347

Mouse Monoclonal Anti-Rat CD2 PE (Clone OX-34) (mouse IgG2a)

RCD002-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD4 PE (Clone W3/25) (mouse IgG1)

RCD004-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD5 PE (Clone OX-19) (mouse IgG1)

RCD005-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD8a PE (Clone OX-8) (mouse IgG1)

RCD008A-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD11a PE (Clone WT.1) (mouse IgG2a)

RCD011A-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD18 PE (Clone WT.3) (mouse IgG1)

RCD018-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD25 PE (Clone OX-39) (mouse IgG1)

RCD025-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD26 PE (Clone OX-61) (mouse IgG2a)

RCD026-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD43 PE (Clone W3/13HLK) (mouse IgG1)

RCD043-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD45 PE (Clone OX-30) (mouse IgG2a)

RCD045-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD45RC PE (Clone OX-22) (mouse IgG1)

RCD045RC-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD48 PE (Clone OX-45) (mouse IgG1)

RCD048-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD62L PE (Clone OX-85)(mouse IgG1)

RCD062L-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD152 PE (Clone WKH 203 ) (mouse IgG1 )

RCD152-PE 100 tests
EUR 469

Mouse IgG1-PE conjugate (isotype control)

20102-101-PE 50 Tests
EUR 164

Mouse IgG2a-PE conjugate (isotype control)

20102-102-PE 50 Tests
EUR 164
We subsequently conclude that the state-of-the-art emb-MRPT2 based mostly on reference wavefunctions generated through emb-CASSCF stays the tactic of alternative for learning floor reactions. emb-ASCI is helpful when massive energetic areas past the restrict of emb-CASSCF are important, resembling to review complicated floor reactions with vital multiconfigurational character (static correlation) however weak dynamic correlation.

Three Novel Entomopathogenic Fungi From China and Thailand

Entomopathogenic fungi are ubiquitous in tropical rainforests and function a excessive stage of range. This group of fungi not solely has necessary ecological worth but in addition medicinal worth. Nevertheless, they’re typically ignored, and many unknown species have but to be found and described. The current examine goals to contribute to the taxonomical and phylogenetic understanding of the genus Paraisaria by describing three new species collected from Guizhou and Yunnan Provinces in China and Krabi Province in Thailand.
The three novel species named Paraisaria alba, P. arcta, and P. rosea share comparable morphologies as these within the genus Paraisaria, containing solitary, easy, fleshy stroma, fully immersed perithecia and cylindrical asci with thickened caps and filiform ascospores that usually disarticulate at maturity. Phylogenetic analyses of mixed LSU, SSU, TEF1-α, RPB1, RPB2, and ITS sequence knowledge verify their placement within the genus Paraisaria. In this examine, the three entomopathogenic taxa are comprehensively described with colour images and phylogenetic analyses. A synopsis desk and a key to all handled species of Paraisaria are additionally included.

First report of alfalfa leaf spot brought on by Leptosphaerulina australis in China

A illness was noticed on alfalfa cultivar WL168 characterised by white to brown leaf spots of normal to spherical shapes, in Aluhorqin County, Inner Mongolia, China (120°13’23″ to 120°29’14″ E, 43°27’52″to 43°35’16″ N, 281.71m to360.13 m Altitude) throughout 2019 to 2020. The illness primarily offered in spring one month after re-greening and the incidence was 78.30% on this discipline.
Twenty alfalfa vegetation with extreme signs had been used for pathogen isolation. The contaminated tissue was reduce into 2 × 2 mm items, surface-sterilized (in 75% ethanol and 5% business bleach (NaClO) for 30 s and 2 min, respectively), rinsed 5 occasions with sterilized distilled water, and dried between sterile filter paper (Wang et al. 2019). The diseased tissue from every plant pattern had been cultured on potato dextrose agar (PDA) and incubated at 25 °C with 12 h mild/day for ten days.
A fungus was remoted from the diseased leaves at a 100% frequency. Fungal development on PDA was spherical with a black floor, radial edge, and a unclean white middle. The ascocarps had been moved to a clear microscope slide to launch asci and ascospores. Ascocarps had been spheroidal, subglobose brown, 120 to 160 µm × 160 to 180 µm, which include a number of ascus. The dimension of ascus had been 31.zero to 41.6 μm × 75.zero to 87.5 μm and every asci having eight ascospores.
Ascospores had been ellipsoid to rectangular with a gelatinous sheath, brown, 8.Eight to 15.zero µm × 29.9 to 43.zero µm with 2 to three horizontal septums, and zero to 2 vertical septums. A phylogenetic tree was constructed after DNA extraction, PCR with primers to amplify the ITS (VG9: 5′- TTACGTCCCTGCCCTTTGTA-3′ and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′) and LSU (LR7: 5′-TACTACCACCAAGATCT-3′ and LROR: 5′- GTACCCGCTGA ACTTAAGC -3′) areas. The LSU (SUB8273071) and ITS (SUB8218291) amplicons confirmed 99% similarity with L. australis (EU754166.1) within the GenBank.
To confirm the pathogenicity, fungs plugs had been inverted on three compound leaves of 20 alfalfa WL168 for 2 days. Agar plugs (PDA) had been inverted on one other 20 alfalfa WL168 three compound leaves which had been management. All vegetation had been maintained at 22 °C and 44% relative humidity in a development chamber. Similar illness signs had been noticed on contaminated leaves ten days after inoculation, whereas management vegetation confirmed no signs.
The similar fungus was re-isolated from the lesions, and additional morphological characterization and molecular assays, as described above. L. australis has been reported on numerous vegetation, together with Prunusarmeniaca, Dolichos, Poa, Lolium, and Vitis in Australia (Graham and Luttrell., 1961), and additionally from Korean soil in 2018 (Weilan et al., 2018). Additionally, L. briosiana, which is frequent within the USA, China, and different nations, causes Leptosphaerulina leaf spot (Samacet al., 2015). L. trifolii is newly reported to happen in China (Liu et al., 2019). To one of the best of our information, that is the primary report of L. australis infecting alfalfa in China. Considering the big planting space in Inner Mongolia, this pathogen might losses to alfalfa cultivation. Hence, future research ought to discover points of efficient administration of this illness.

Four new species of Talaromyces part Talaromyces found in China

Four new Talaromyces species with none shut kinfolk are reported right here, specifically, T. aureolinus (ex-type AS3.15865 T), T. bannicus (ex-type AS3.15862 T), T. penicillioides (ex-type AS3.15822 T), and T. sparsus (ex-type AS3.16003 T). Morphologically, T. aureolinus is exclusive in producing orange-yellow mycelium and gymnothecia, singly borne asci, and ellipsoidal, spiny ascospores.
Three Novel Entomopathogenic Fungi From China and Thailand
 Talaromyces bannicus is characterised by the sluggish development price, polymorphic conidiophores, inconsistent stipe lengths, and pyriform to ellipsoidal, echinulate conidia. Talaromyces penicillioides is distinguished by good development and sporulation on malt extract agar (MEA) and yeast extract sucrose agar (YES) media, resembling the colony appearances of sure Penicillium species, and appressed biverticillate and sometimes monoverticillate penicilli bearing globose to ellipsoidal, echinulate conidia.

FSCN1 Antibody

1-CSB-PA619084LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FSCN1 Antibody

DF7988 200ul
EUR 304
Description: FSCN1 Antibody detects endogenous levels of total FSCN1.

FSCN1 Antibody

1-CSB-PA182867
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

FSCN1 Antibody

1-CSB-PA203862
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

Fscn1 antibody

70R-8641 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fscn1 antibody

FSCN1 Antibody

1-CSB-PA009010GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FSCN1 Antibody

ABD7988 100 ug
EUR 438

FSCN1 Monoclonal Antibody

A1062-50
EUR 300

Fascin (FSCN1) Antibody

20-abx006708
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx214267
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (Fscn1) Antibody

20-abx112474
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx126914
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx141208
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx032965-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx032965-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx241222
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FSCN1 Conjugated Antibody

C35636 100ul
EUR 397

Fascin (FSCN1) Antibody

20-abx327559
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx338423
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx432714-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fascin (FSCN1) Antibody

abx233018-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-FSCN1 antibody

STJ27695 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ115318 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ23712 100 µl
EUR 413
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ71472 100 µg
EUR 359

Fscn1/ Rat Fscn1 ELISA Kit

ELI-05701r 96 Tests
EUR 886

FSCN1 siRNA

20-abx902015
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 siRNA

20-abx917244
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 siRNA

20-abx917245
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 Antibody, HRP conjugated

1-CSB-PA619084LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FSCN1 Antibody, FITC conjugated

1-CSB-PA619084LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FSCN1 Antibody, Biotin conjugated

1-CSB-PA619084LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FSCN1 Polyclonal Conjugated Antibody

C30401 100ul
EUR 397

Fascin (FSCN1) Antibody (HRP)

20-abx335658
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (FITC)

20-abx335659
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (Biotin)

20-abx335660
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Fascin/FSCN1 Antibody

PA1575 100ug/vial
EUR 294

Anti-Fascin/FSCN1 Antibody

PB9592 100ug/vial
EUR 294

FSCN1 Rabbit pAb

A13355-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb

A13355-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb

A13355-20ul 20 ul
EUR 183

FSCN1 Rabbit pAb

A13355-50ul 50 ul
EUR 223

Fscn1 Blocking Peptide

33R-9865 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fscn1 antibody, catalog no. 70R-8641

FSCN1 Blocking Peptide

DF7988-BP 1mg
EUR 195

FSCN1 cloning plasmid

CSB-CL619084HU-10ug 10ug
EUR 524
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atgaccgccaacggcacagccgaggcggtgcagatccagttcggcctcatcaactgcggcaacaagtacctgacggccgaggcgttcgggttcaaggtgaacgcgtccgccagcagcctgaagaagaagcagatctggacgctggagcagccccctgacgaggcgggcagcgcgg
  • Show more
Description: A cloning plasmid for the FSCN1 gene.

FSCN1 Rabbit pAb

A5867-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb

A5867-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb

A5867-20ul 20 ul Ask for price

FSCN1 Rabbit pAb

A5867-50ul 50 ul Ask for price

[KO Validated] FSCN1 Polyclonal Antibody

30401-100ul 100ul
EUR 252

[KO Validated] FSCN1 Polyclonal Antibody

30401-50ul 50ul
EUR 187

Polyclonal FSCN1 Antibody (internal region)

APR16037G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FSCN1 (internal region). This antibody is tested and proven to work in the following applications:

Fascin-1(FSCN1/416) Antibody

BNUB0416-100 100uL
EUR 209
Description: Primary antibody against Fascin-1(FSCN1/416), Concentration: 0.2mg/mL

Fascin-1(FSCN1/416) Antibody

BNUB0416-500 500uL
EUR 458
Description: Primary antibody against Fascin-1(FSCN1/416), Concentration: 0.2mg/mL

Fascin-1(FSCN1/417) Antibody

BNUB0417-100 100uL
EUR 209
Description: Primary antibody against Fascin-1(FSCN1/417), Concentration: 0.2mg/mL

Fascin-1(FSCN1/417) Antibody

BNUB0417-500 500uL
EUR 458
Description: Primary antibody against Fascin-1(FSCN1/417), Concentration: 0.2mg/mL

Fascin-1(FSCN1/418) Antibody

BNUB0418-100 100uL
EUR 209
Description: Primary antibody against Fascin-1(FSCN1/418), Concentration: 0.2mg/mL

Fascin-1(FSCN1/418) Antibody

BNUB0418-500 500uL
EUR 458
Description: Primary antibody against Fascin-1(FSCN1/418), Concentration: 0.2mg/mL

Fascin-1(FSCN1/416) Antibody

BNUM0416-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/416), 1mg/mL

Fascin-1(FSCN1/417) Antibody

BNUM0417-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/417), 1mg/mL

Fascin-1(FSCN1/418) Antibody

BNUM0418-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/418), 1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC040416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC040416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC040417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC040417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC040418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC040418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC610416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC610416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC610417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC610417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC610418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC610418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC470416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC470416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC470417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC470417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC470418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC470418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC550416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC550416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC550417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC550417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC550418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC550418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC050416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC050416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC050417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC050417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC050418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC050418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC400416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC400416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC400417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC400417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC400418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF640R conjugate, Concentration: 0.1mg/mL
 Talaromyces sparsus has extensive, submerged colony margins with sparse aerial mycelium, and conidial areas overlaid with yellow-green, sterile hyphae on MEA medium. These 4 new species are effectively supported by particular person phylogenetic timber based mostly on β-tubulin (BENA), calmodulin (CALM), DNA-dependent RNA polymerase II second largest subunit (RPB2), and inside transcribed spacer area (ITS) gene sequences and the tree of the concatenated BENA-CALM-RPB2 sequence.

miR-495 reduces neuronal cell apoptosis and relieves acute spinal cord injury through inhibiting PRDM5

This research goals to research the position of miR-495 in neuronal cell apoptosis after acute spinal cord injury (ASCI). The ASCI rat mannequin was established and the Basso, Beattie, and Bresnahan (BBB) rating was assessed. miR-495, PR area containing 5 (PRDM5), and Bcl-2 expressions have been measured by qRT-PCR or western blotting. Neuronal cell line PC-12 was subjected to hypoxia situation to simulate the in vitro ASCI mannequin. PC-12 cell apoptosis was measured by movement cytometry, and the interplay between miR-495 and PRDM5 was confirmed by twin luciferase reporter assay.

Results confirmed that BBB rating was considerably decreased in ASCI rats in contrast with sham rats. miR-495 expression was down-regulated in spinal cord tissue of ASCI rats and hypoxia-induced PC-12 cells, and PRDM5 protein stage was up-regulated in spinal cord tissue of ASCI rats and hypoxia-induced PC-12 cells. miR-495 overexpression may cut back apoptosis of PC-12 cells, and up-regulated anti-apoptosis protein Bcl-2 protein stage.

Moreover, PRDM5 was a goal of miR-495, and mRNA and protein ranges of PRDM5 have been negatively regulated by miR-495. miR-495 overexpression may cut back the hypoxia-induced PC-12 cell apoptosis, whereas PRDM5 overexpression abolished this inhibiting impact. The agomir-495 was injected into ASCI rats, and Bcl-2 protein stage and BBB rating have been elevated, however the PRDM5 overexpression reversed these outcomes. Overall, we concluded that miR-495 may inhibit neuronal cell apoptosis and relieve acute spinal cord injury through inhibiting PRDM5.

Second-Order Orbital Optimization with Large Active Spaces Using Adaptive Sampling Configuration Interaction (ASCI) and Its Application to Molecular Geometry Optimization

Recently, chosen configuration interplay (SCI) strategies that allow calculations with a number of tens of lively orbitals have been developed. With the SCI subspace embedded within the imply area, molecular orbitals with an accuracy akin to that of the whole lively area self-consistent area methodology will be obtained. Here, we implement the analytical gradient concept for the single-state adaptive sampling CI (ASCI) SCF methodology to allow molecular geometry optimization.
The ensuing analytical gradient is inherently approximate because of the dependence on the sampled determinants, however its accuracy was adequate for performing geometry optimizations with giant lively areas. To acquire the tight convergence wanted for correct analytical gradients, we mix the augmented Hessian (AH) and Werner-Meyer-Knowles (WMK) second-order orbital optimization strategies with the ASCI-SCF methodology. We take a look at these algorithms for orbital and geometry optimizations, display functions of the geometry optimizations of polyacenes and periacenes, and talk about the geometric dependence of the traits of singlet ASCI wave features.

First report of Erysiphe corylacearum, agent of powdery mildew, on hazelnut ( Corylus avellana) in Romania

Romania has an space devoted to hazelnut (Corylus avellana L.), protecting 890 hectares as of 2019. During October 2020, powdery mildew signs have been noticed on the higher facet of leaves of hazelnut ‘Tonda di Giffoni’ in two business orchards in Dudeștii Vechi, Romania (Fig. 1). The illness was current on 70% of the bushes in planting, with no less than 5 leaves per tree having powdery mildew. Micromorphological examination revealed amphigenous, hyaline, branched, septate mycelial patches of two.
Three to three.6 μm in diameter. Conidiophores measured 24-60 × 5-6 (common: 45 × 6) μm and consisted of erect, cylindrical to flexuous foot cells, adopted by 1-2 shorter cells. Ellipsoid, ovoid to doliform conidia have been produced singly and they measured 19-35 × 16-24 (common: 28 × 19) μm. Chasmothecia have been spherical, 75 to 107 (common: 88) μm in diameter. Nine to 13 straight, generally flexuous, appendages measured 54 to 92 (common: 66) μm in size and that they had 5 occasions dichotomous branched apices with curved suggestions (Fig. 2). Each chasmothecium contained three to 5 ellipsoid, ovoid to subglobose asci measuring 41-58 × 29-55 μm (common 52 × 43) μm.
miR-495 reduces neuronal cell apoptosis and relieves acute spinal cord injury through inhibiting PRDM5
The asci contained 4 to eight ascospores measuring 13-24 × 11-15 (common 18 × 14) μm. Morphological identification was confirmed by sequencing the ITS-region of rDNA utilizing two isolates from leaves, saved as frozen mycelium at -20°C. PCR was carried out with Erysiphales-specific primer pair PMITS1/PMITS2 (Cunnington et al. 2003). The obtained sequences have been deposited in GenBank (Accession n° MW423075, MW423076).
Blast evaluation of each sequences had 100% identification to ITS rDNA sequences of Erysiphe corylacearum from Azerbaijan (Abasova et al. 2018; Accession n° LC270863), Turkey (Sezer et al. 2017; KY082910), Switzerland (Beenken et al. 2020; MN82272), Iran (Arzanlou et al. 2018; MH047243), Italy (Mezzalama et al. 2020; MW045425) and 99% identification from Georgia (Meparishvili et al. 2019; MK157199).
The sequences had a decrease % identification (83%) to Phyllactinia guttata (Accession n° AB080558) (Fig. 3). Pathogenicity was verified on one-year-old vegetation of C. avellana ‘Tonda di Giffoni’, which have been artificially inoculated with a conidial suspension from contaminated leaves (n = 25). Inoculated vegetation have been incubated at 20 to 28°C with 70 to 80% relative humidity.
White mycelium appeared on the higher floor of the leaves at eight to 10 days after inoculation. No signs have been discovered on management vegetation sprayed with sterile water. The fungus current on inoculated leaves was morphologically an identical to the unique isolates from diseased bushes from the sector. E. corylacearum is native to East Asia and was beforehand reported in Japan on wild species of Corylus (Takamatsu et al. 2015; Accession n° LC009928).
The pathogen more than likely unfold into Europe from east to west of Europe (Heluta et al. 2019), through the Caucasus, ranging from Turkey, Azerbaijan, Georgia, and Iran. P. guttata was thought of the one causal agent of powdery mildew on hazelnut in most international locations, together with Romania (Brown 1995). Compared to P. guttata, which typically develops a mycelium on the underside of leaves, E. corylacearum grows with a white mycelium on the higher facet of the leaves.

TNN Conjugated Antibody

C37267 100ul
EUR 397

TNN siRNA

20-abx937676
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNN siRNA

20-abx937677
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNN Antibody, HRP conjugated

1-CSB-PA892498LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNN Antibody, FITC conjugated

1-CSB-PA892498LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNN Antibody, Biotin conjugated

1-CSB-PA892498LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Tenascin-N (TNN) Antibody

abx027503-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

abx027503-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

20-abx213586
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

20-abx213587
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human TNN ELISA Kit

ELA-E6753h 96 Tests
EUR 824

TNN ELISA KIT|Human

EF006402 96 Tests
EUR 689

Mouse TNN shRNA Plasmid

20-abx983554
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TNN shRNA Plasmid

20-abx961862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal TNN antibody - N-terminal region

AMM08262G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNN - N-terminal region. This antibody is tested and proven to work in the following applications:

Tnn ORF Vector (Rat) (pORF)

ORF078047 1.0 ug DNA
EUR 2080

TNN ORF Vector (Human) (pORF)

ORF034128 1.0 ug DNA
EUR 405

Tnn ORF Vector (Mouse) (pORF)

ORF060119 1.0 ug DNA
EUR 1572

TNN ELISA Kit (Mouse) (OKEH05060)

OKEH05060 96 Wells
EUR 779
Description: Description of target: Isoform 2 inhibits neurite outgrowth and cell migration in hippocampal explants while isoform 1 does not have this affect.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.8 pg/mL

Human Tenascin-N(TNN) ELISA kit

CSB-EL024008HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenascin-N (TNN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tenascin-N(TNN) ELISA kit

1-CSB-EL024008HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenascin-N(TNN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tenascin-N (TNN) ELISA Kit

abx251701-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human TNN(Tenascin-N) ELISA Kit

EH2345 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9UQP3
  • Alias: TNN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Tnn/ Tenascin-N ELISA Kit

E1507Mo 1 Kit
EUR 632

Human TNN/ Tenascin-N ELISA Kit

E2557Hu 1 Kit
EUR 605

Human Tenascin- N, TNN ELISA KIT

ELI-07573h 96 Tests
EUR 824

Mouse Tenascin- N, Tnn ELISA KIT

ELI-07574m 96 Tests
EUR 865

Mouse Tenascin-N (TNN) ELISA Kit

abx520606-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Tnn sgRNA CRISPR Lentivector set (Rat)

K6576501 3 x 1.0 ug
EUR 339

Tnn sgRNA CRISPR Lentivector set (Mouse)

K3893901 3 x 1.0 ug
EUR 339

TNN sgRNA CRISPR Lentivector set (Human)

K2419101 3 x 1.0 ug
EUR 339

Human Tenascin N(TNN)ELISA Kit

QY-E03057 96T
EUR 361

Tnn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6576502 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6576503 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6576504 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3893902 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3893903 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3893904 1.0 ug DNA
EUR 154

TNN sgRNA CRISPR Lentivector (Human) (Target 1)

K2419102 1.0 ug DNA
EUR 154

TNN sgRNA CRISPR Lentivector (Human) (Target 2)

K2419103 1.0 ug DNA
EUR 154

TNN sgRNA CRISPR Lentivector (Human) (Target 3)

K2419104 1.0 ug DNA
EUR 154

ELISA kit for Mouse Tenascin-N (TNN)

KTE70103-48T 48T
EUR 332
  • TNN (Tenascin N) is a Protein Coding gene. Diseases associated with TNN include Dysplastic Nevus Syndrome. Among its related