First Report of Erysiphe palczewskii Powdery Mildew of Siberian Pea Tree (Caragana arborescens) in Wisconsin and Quebec.

Shoots affected by powdery mildew had been collected from Siberian pea bushes in July 2009 on the University of Wisconsin-Madison campus and on the campus of Université Laval, Quebec City, Quebec. This unique shrub or small tree is occasionally planted in Wisconsin and three shrubs in a bunch that had been affected are the one examples identified on the UW-Madison campus.
In Quebec City, Siberian pea tree is extra generally used as a decorative, usually in hedges (as is the case of the affected vegetation on the Université Laval campus). In each areas, <10% of foliage was visibly affected, however incidence was better on shoots nearer to the bottom than on increased shoots. White-to-grayish mycelium was current on leaves and younger stems and generally utterly lined each higher and decrease leaf surfaces. Dark brown-to-black chasmothecia had been quite a few on leaf blades, petioles, and younger stems, however had been most plentiful on decrease surfaces of leaves.
Morphology of chasmothecia, together with appendages with distinctive terminal dichotomous branching, (1) was in line with descriptions and illustrations of the fungus Erysiphe palczewskii Jacz. (synonym Microsphaera palczewskii) (1-4) considered native to Asia, however often known as an invader of Europe the place it happens on the identical host. For a pattern from Université Laval, imply diameter of chasmothecia was 113 μm, imply appendage size was 185 μm, and barrel-shaped conidia that lacked fibrosin our bodies averaged 30 × 14 μm. Asci contained oval, yellow ascospores with imply dimensions of 20 × 12 μm.
DNA was extracted from chasmothecia, and nuclear rDNA sequences (633 nucleotides) of the Wisconsin (GenBank Accession No. GQ497277) and Quebec (GenBank Accession No. GQ497276) specimens differed by just one nucleotide. The sequences that had been obtained most intently matched GenBank sequences for Oidium spp. (98%) and Erysiphe spp. (97%). Further observations indicated that the identical pathogen affected Siberian pea bushes planted as ornamentals at a number of areas separated by ≥15 km in the metropolitan Quebec space.
This report extends the japanese identified restrict of E. palczewskii in the United States, beforehand identified from collections in Alaska (2), Washington (4), Idaho (4), North Dakota (3), and Minnesota (3). To our information, that is the primary report of this illness in Canada, and it signifies that the distribution of E. palczewskii is transcontinental.
Specimens from Madison, WI and Quebec, QC have been deposited in the U.S. National Fungus Collections (BPI 879152) and the Rene Pomerleau Herbarium of the Canadian Forest Service Laurentian Forestry Centre (QFB-22601). References: (1) U. Braun. Beih. Nova Hedwigia 89:1, 1987. (2) D. A. Glawe and G. A. Laursen. Online publication. doi:10:1094/PHP-2005-1017-01-BR. Plant Health Progress, 2005. (3) D. A. Glawe et al. Online publication. doi:10.1094/PHP-2006-0117-01-BR. Plant Health Progress, 2006. (4) C. Nischwitz and G. Newcombe. Plant Dis. 87:451, 2003.

First Report of Powdery Mildew Caused by Golovinomyces biocellatus on Peppermint in California.

In August of 2009, powdery mildew was noticed on peppermint (Mentha piperita L.) in a number of industrial fields in the Fall River Valley of japanese Shasta County, California. Plant progress was apparently diminished by the illness, however its affect on yield was unknown. White fungal progress was restricted to the adaxial surfaces, the place colonies had been skinny and effused. Heavily contaminated leaves developed a reddish tint as progress prematurely ceased. Doliform conidia ([26.6-] 29.2 [-31.7] × [13.2-] 15.6 [-16.8] μm) had been produced in chains of roughly six conidia.
Foot cells had been cylindrical ([41.3-] 55.2 [-75.0] × [11.2-] 12.0 [-12.8] μm). Immature chasmothecia had been yellowish brown and roughly 100.Zero μm in diameter with flexuous, mycelium-like appendages as much as 200 μm lengthy. All these options had been in line with these of Golovinomyces biocellatus. Asci weren’t noticed. To affirm the identification of the fungus, nuclear rDNA inside transcribed spacer (ITS) areas had been amplified by PCR with common primers ITS4 and ITS5.
The sequence (537 bp) was a precise match for a number of submissions of G. biocellatus in GenBank (e.g., Accession No. EU035602, a sequence of the fungus from mint in Australia [1]). Pathogenicity was confirmed by brushing spores from naturally contaminated leaves onto three rooted cuttings of M. piperita ‘Black Mitchum’. After the vegetation had been lined with a plastic bag for 36 h to keep up excessive humidity, they had been stored on a greenhouse bench at 23 to 28°C.
Three noninoculated vegetation, which served as controls, had been positioned in one other greenhouse in related situations. The experiment was repeated as soon as. All inoculated vegetation developed indicators of powdery mildew inside 7 days of inoculation whereas noninoculated vegetation remained illness free. The fungus on inoculated leaves was morphologically indistinguishable from the one used to inoculate the vegetation. To our information, that is the primary report of G. biocellatus on peppermint in California. References: (1) J. R. Liberato and J. H. Cunnington. Australas, Plant Dis. Notes 2:38, 2007.

Root and Crown Rot of Anthurium Caused by Calonectria ilicicola in Iran.

In the autumn of 2008, a extreme illness of Anthurium andraeanum with wilting and root and crown rot signs was noticed in a greenhouse in the Varamin space of Tehran. A species of Calonectria was remoted constantly from symptomatic tissues on 2% potato dextrose agar (PDA). The fungus produced perithecia and a Cylindrocladium anamorph when incubated on carnation leaf agar beneath near-ultraviolet mild at 25°C. Perithechia had been reddish brown, subglobose to ovoid, and 300 to 400 μm in diameter. Asci had been clavate, hyaline, 90 to 140 × 12 to 19 μm, and tapering to a protracted skinny stalk.
 First Report of Erysiphe palczewskii Powdery Mildew of Siberian Pea Tree (Caragana arborescens) in Wisconsin and Quebec.
Ascospores had been fusoid, straight to barely curved, 1- (-3) septate, and (30-) 37 to 50 (-65) × (4-) 5 to six.5 (-7) μm (imply = 45 × 6 μm; n = 30). Penicillate conidiophores gave rise to stipe extensions that terminated in sphaeropedunculate vesicles (6-) 7 to 10 (-12) μm in diameter. Conidia had been hyaline, cylindrical, rounded at each ends, straight, (45-) 70 to 82 (-90) × (4-) 5 to six.5(-7) μm (imply = 62 × 6 μm; n = 30), and (1-) 3-septate. On the premise of morphology, the fungus was recognized as Calonectria ilicicola Boedijin & Reitsma.
Koch’s postulates had been fulfilled by spray inoculating 1-month-old seedlings with a conidial and mycelial suspension (105 particles per ml) of the fungus obtained from 14-day-old single-spore colonies grown on PDA at 25°C. Following inoculation, all vegetation had been maintained in plastic baggage in a glasshouse at 25 ± 1°C. After 15 to 25 days, signs resembling these seen in the diseased glasshouse had been detected on inoculated vegetation. C. ilicicola was reisolated from the artificially contaminated tissues.
No signs had been detected on the management vegetation. Nucleotide sequences of the interior transcribed spacer (ITS) areas of the nrDNA operon and the partial histone H3 gene had been decided for derived pressure CPC 16334 as described beforehand (1,3). The ITS sequence (GenBank Accession No. GU057378) matched 100% (644/644 bp) with the sequence of C. ilicicola pressure CBS 463.76 (GenBank AF493963) and the histone H3 sequence (GenBank GU057379) matched 99% (456/458 bp; as a result of two versus three AC repeats in the sequence) with that of C.

Human Neurofascin (NFASC) ELISA Kit

RDR-NFASC-Hu-48Tests 48 Tests
EUR 589

Human Neurofascin (NFASC) ELISA Kit

RDR-NFASC-Hu-96Tests 96 Tests
EUR 820

Neurofascin (NFASC) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurofascin (NFASC) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurofascin (NFASC) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurofascin (NFASC) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurofascin (NFASC) Antibody

abx431852-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Neurofascin (NFASC) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Neurofascin (NFASC)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 15.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neurofascin(NFASC),partial expressed in E.coli

Recombinant Neurofascin (NFASC)

  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O94856
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Neurofascin expressed in: E.coli

Human Neurofascin (NFASC) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Neurofascin (NFASC) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC)

Neurofascin (NFASC) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with Biotin.

Neurofascin (NFASC) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with Cy3.

Neurofascin (NFASC) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with FITC.

Neurofascin (NFASC) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with HRP.

Neurofascin (NFASC) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with PE.

Neurofascin (NFASC) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with APC.

Human Neurofascin (NFASC) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurofascin, NFASC ELISA KIT

ELI-20708h 96 Tests
EUR 824

Chicken Neurofascin, NFASC ELISA KIT

ELI-15003c 96 Tests
EUR 928

Mouse Neurofascin, Nfasc ELISA KIT

ELI-45737m 96 Tests
EUR 865

Human Neurofascin (NFASC) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Neurofascin (NFASC) ELISA Kit

abx390014-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neurofascin (NFASC) ELISA Kit

abx391685-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neurofascin(NFASC) ELISA kit

CSB-EL015743HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurofascin (NFASC) in samples from serum, plasma, cerebrospinalfluid (CSF), tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neurofascin(NFASC) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurofascin(NFASC) in samples from serum, plasma, cerebrospinalfluid(CSF), tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Neurofascin(NFASC)ELISA Kit

QY-E01656 96T
EUR 394

Human Neurofascin (NFASC) ELISA Kit

SEL939Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofascin (NFASC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofascin (NFASC) in Tissue homogenates and other biological fluids.

Human Neurofascin (NFASC) ELISA Kit

SEL939Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofascin (NFASC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofascin (NFASC) in Tissue homogenates and other biological fluids.

Human Neurofascin (NFASC) ELISA Kit

SEL939Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofascin (NFASC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofascin (NFASC) in Tissue homogenates and other biological fluids.

Human Neurofascin (NFASC) ELISA Kit

SEL939Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofascin (NFASC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofascin (NFASC) in Tissue homogenates and other biological fluids.

Human Neurofascin (NFASC) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurofascin elisa. Alternative names of the recognized antigen: NF
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurofascin (NFASC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Neurofascin (NFASC) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with APC-Cy7.

ELISA kit for Human NFASC (Neurofascin)

ELK6104 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurofascin (NFASC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurofascin (N
  • Show more
Description: A sandwich ELISA kit for detection of Neurofascin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rabbit Anti- Rat neurofascin (Nfasc)-phospor IgG (aff pure)

AB-23249-A 100ug
EUR 482

Nfasc ELISA Kit| Rat Neurofascin ELISA Kit

EF019045 96 Tests
EUR 689

Nfasc ELISA Kit| Mouse Neurofascin ELISA Kit

EF015653 96 Tests
EUR 689

NFASC ELISA Kit| chicken Neurofascin ELISA Kit

EF012420 96 Tests
EUR 689

Rat neurofascin (Nfasc)-control Control/blocking peptide

AB-23249-CP 100ug
EUR 164

Rat neurofascin (Nfasc)-phosphor Control/blocking peptide

AB-23249-P 100ug
EUR 164

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-100ug

QP6416-ec-100ug 100ug
EUR 408

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-10ug

QP6416-ec-10ug 10ug
EUR 200

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-1mg

QP6416-ec-1mg 1mg
EUR 1632

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-200ug

QP6416-ec-200ug 200ug
EUR 634

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-500ug

QP6416-ec-500ug 500ug
EUR 1060

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-50ug

QP6416-ec-50ug 50ug
EUR 263

Anti-NFASC antibody

STJ24750 100 µl
EUR 277
Description: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined.

Anti-Neurofascin (aa877-890) antibody

STJ72603 100 µg
EUR 359

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349


PR15066 50 ug
EUR 468

NFASC Antibody

ABD7160 100 ug
EUR 438

NFASC antibody

38553-100ul 100ul
EUR 252

NFASC Antibody

31250-100ul 100ul
EUR 252

NFASC Antibody

31250-50ul 50ul
EUR 187

NFASC Antibody

DF7160 200ul
EUR 304
Description: NFASC Antibody detects endogenous levels of total NFASC.

NFASC Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NFASC. Recognizes NFASC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NFASC Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NFASC. Recognizes NFASC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

NFASC Conjugated Antibody

C38553 100ul
EUR 397

NFASC Conjugated Antibody

C31250 100ul
EUR 397

Nfasc/ Rat Nfasc ELISA Kit

ELI-22181r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

NFASC Rabbit pAb

A3053-100ul 100 ul
EUR 308

NFASC Rabbit pAb

A3053-200ul 200 ul
EUR 459

NFASC Rabbit pAb

A3053-20ul 20 ul
EUR 183

NFASC Rabbit pAb

A3053-50ul 50 ul
EUR 223

NFASC Blocking Peptide

DF7160-BP 1mg
EUR 195

Polyclonal Neurofascin (aa877-890) Antibody (internal region)

AMM06631G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Neurofascin (aa877-890) (internal region). This antibody is tested and proven to work in the following applications:

Rat NFASC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NFASC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF005338 96 Tests
EUR 689

Human NFASC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NFASC ORF Vector (Human) (pORF)

ORF026068 1.0 ug DNA
EUR 405

Nfasc ORF Vector (Rat) (pORF)

ORF071257 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Rat) (pORF)

ORF071258 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Rat) (pORF)

ORF071259 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Rat) (pORF)

ORF071260 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Mouse) (pORF)

ORF051272 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Mouse) (pORF)

ORF051273 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Mouse) (pORF)

ORF051274 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Mouse) (pORF)

ORF051275 1.0 ug DNA
EUR 506

NFASC ELISA Kit (Human) (OKCD01074)

OKCD01074 96 Wells
EUR 909
Description: Description of target: Cell adhesion, ankyrin-binding protein which may be involved in neurite extension, axonal guidance, synaptogenesis, myelination and neuron-glial cell interactions.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

NFASC sgRNA CRISPR Lentivector set (Human)

K1420901 3 x 1.0 ug
EUR 339

Nfasc sgRNA CRISPR Lentivector set (Mouse)

K4184901 3 x 1.0 ug
EUR 339

Nfasc sgRNA CRISPR Lentivector set (Rat)

K7550101 3 x 1.0 ug
EUR 339

NFASC sgRNA CRISPR Lentivector (Human) (Target 1)

K1420902 1.0 ug DNA
EUR 154

NFASC sgRNA CRISPR Lentivector (Human) (Target 2)

K1420903 1.0 ug DNA
EUR 154

NFASC sgRNA CRISPR Lentivector (Human) (Target 3)

K1420904 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4184902 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4184903 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4184904 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Rat) (Target 1)

K7550102 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Rat) (Target 2)

K7550103 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Rat) (Target 3)

K7550104 1.0 ug DNA
EUR 154

NFASC Protein Vector (Human) (pPB-C-His)

PV104270 500 ng
EUR 552

NFASC Protein Vector (Human) (pPB-N-His)

PV104271 500 ng
EUR 552

NFASC Protein Vector (Human) (pPM-C-HA)

PV104272 500 ng
EUR 552

NFASC Protein Vector (Human) (pPM-C-His)

PV104273 500 ng
EUR 552

NFASC Protein Vector (Rat) (pPB-C-His)

PV285026 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-N-His)

PV285027 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-HA)

PV285028 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-His)

PV285029 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-C-His)

PV285030 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-N-His)

PV285031 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-HA)

PV285032 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-His)

PV285033 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-C-His)

PV285034 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-N-His)

PV285035 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-HA)

PV285036 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-His)

PV285037 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-C-His)

PV285038 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-N-His)

PV285039 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-HA)

PV285040 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-His)

PV285041 500 ng
EUR 1191

NFASC Protein Vector (Mouse) (pPB-C-His)

PV205086 500 ng
EUR 1065

NFASC Protein Vector (Mouse) (pPB-N-His)

PV205087 500 ng
EUR 1065

NFASC Protein Vector (Mouse) (pPM-C-HA)

PV205088 500 ng
EUR 1065
ilicicola pressure CBS 112217 (GenBank AY725686). To our information, that is the primary report of Calonectria and Cylindrocladium genera and the illness brought on by C. ilicicola from Iran. References: (1) R. Cheewangkoon et al. Persoonia 23:55, 2009. (2) P. W. Crous and M. J. Wingfield. Mycotaxon 51:341, 1994. (3) P. W. Crous et al. Stud. Mycol. 50:415, 2004.

Mycosphaerangium and Neomelanconium (Cenangiaceae) are closest relatives: phylogenetic relationships, morphology and a new species

Based on molecular phylogenetic analyses of a multigene matrix of partial nuSSU-ITS-LSU rDNA, RPB1RPB2 and TEF1 sequences and by morphological proof, the genus Mycosphaerangium is proven to be the closest relative of Neomelanconium, and confirmed to be a member of the Cenangiaceae (Leotiomycetes). While Mycosphaerangium and Neomelanconium share many traits like comparable conidia, conidiogenesis, asci and ascospores, their apothecia differ notably in excipular options and are subsequently acknowledged as distinct genera.
Mycosphaerangium tiliae, described from North America, is excluded from the genus however proven to characterize the sexual morph of the European Neomelanconium gelatosporum, and it’s subsequently synonymized with the latter. Based on morphology, Neomelanconium deightonii is assumed to be congeneric with Neomelanconium gelatosporum, and it’s lectotypified.
Dermatea tetraspora and Phaeangium magnisporum, the basionyms of Mycosphaerangium tetrasporum and M. magnisporum, respectively, are lectotypified as effectively, and for M. tetrasporum, the asexual morph is recorded for the primary time. Mycosphaerangium quercinum sp. nov. is described as a new species from numerous Quercus hosts in Europe, the place it’s proven to be extensively distributed.
It morphologically and ecologically carefully resembles the North American M. tetrasporum, however differs in paraphysis and ascospore morphology and by croziers at its ascus base. The three accepted species of Mycosphaerangium and the 2 of Neomelanconium are described and illustrated. Mycosphaerangium magnisporumM. quercinum and M. tetrasporum are recorded to be consistently related to species of Coryneum, indicating a fungicolous behavior, however no proof for fungal associations has been present in Neomelanconium deightonii and N. gelatosporum.

First report of seedling blight of maize brought on by Fusarium asiaticum in Northeast China

Maize [Zea mays L.] is a vital meals and feed crops in northeast of China. In 2019, maize seedling blight with an incidence of as much as 25% was discovered on the subject in Fushun metropolis of Liaoning Province. Typical signs of seedlings have been yellow, skinny, wilt and die. The leaves steadily turned yellow from the bottom of the plant to the highest. Root system was poorly developed.
The major roots have been normally discolored and rotted. And faintly pink or puce-coloured mould was discovered on seeds of the rotted seedings. Symptomatic roots of diseased seedling have been collected and surface-disinfested with 70% ethanol for 1 min and then in 2% NaClO for Three min, rinsed with sterilized water thrice, lower into small items and positioned on potato dextrose agar (PDA) medium for five days at 25 °C. Colonies on PDA have been pink to darkish purple with fluffy aerial mycelium and purple to aubergine pigmentation with the age.
The causal agent was transferred to carnation leaf agar (CLA) medium and incubated at 25°C below a 12-h light-dark cycle. 12 Pure cultures have been obtained from single conidia with an inoculation needle below stereomicroscope. The harvested macroconidia have been hyaline, falcate with single foot cells, 3-5 septate and 28.2- 43.5 μm × 3.7 – 4.9 μm. Chlamydospores have been globose to subglobose (5 to 13.5 μm).
No microconidia have been discovered. The perithecia have been black, ostiolate subglobose. Asci have been hyaline, clavate, measuring 58.1- 83.9 µm × 7.7- 11.9 µm and contained eight ascospores. Morphological characters of the pathogen agreed effectively with descriptions of Fusarium asiaticum (O’Donnell et al.2004; Leslie and Summerell 2006). To verify the identification, partial translation elongation issue 1 alpha (TEF1-a) gene and rDNA inside transcribed spacer (ITS) area of isolate MSBL-Four have been amplified and sequenced (O’Donnell et al. 2015; White et al.1990).
BLASTn evaluation of each TEF sequence (MT330257) and ITS sequence (MT322117), revealed 100% sequence identification with F. asiaticum KT380116 and KX527878, respectively. The isolate MSBL-Four was NIV chemotype as decided by Tri13F/DON, Tri13NIV/R (Chandler et al, 2003) assays. Pathogenicity research have been carried out on maize hybrid “Liaodan 565”. Inoculum of F. asiaticum was ready from the tradition of MSBL-Four incubate in 2% mung beans juice on a shaker (150 rpm) at 25°C for 48 hours.
The 5 liter pots (10 pots) have been crammed with sterilized subject soil and 5 of them have been blended with conidial suspension (300mL in every pot) at 2 × 105 conidia per ml. Ten kernels per pot have been floor disinfected in 2% sodium hypochlorite for five min, rinsed with sterilized water and planted. Five pots have been inoculated and one other uninoculated 5 pots served as controls. The pots have been maintained in a greenhouse at 22-26°C for 40 days. Leaves of the vegetation in inoculated pots have been yellowing and the roots turned discolored or necrotic rot at Four weeks after seedling emergence.
Mycosphaerangium and Neomelanconium (Cenangiaceae) are closest relatives: phylogenetic relationships, morphology and a new species
All traits of the illness have been just like these noticed in subject. Non-inoculated management vegetation had no signs. Fusarium asiaticum was reisolated from inoculated vegetation and was an identical to the unique isolate. The experiment was repeated as soon as with comparable outcomes. To our information, that is the primary report of seedling blight brought on by F. asiaticum on maize in northeast China, and it has posed a risk to maize manufacturing of China. References: Leslie J F and Summerell BA. 2006. The Fusarium laboratory guide. Blackwell Publishing, Ames, pp 176-179. O’Donnell et al.2004. Fungal Genetics and Biology 41: 600-623. O’ Donnell et al. 2015. Phytoparasitica 43:583-595. White T J et al. 1990. Academic Press, San Diego, CA, pp 315-322. Chandler E A et al. 2003. Physiological and Molecular Plant Pathology 62(6): 355-367.

Benchmarking an Embedded Adaptive Sampling Configuration Interaction Method for Surface Reactions: H 2 Desorption from and CH 4 Dissociation on Cu(111)

Embedded (emb-) correlated wavefunction (CW) principle allows correct assessments of each ground- and excited-state response mechanisms concerned in heterogeneous catalysis. Embedded multireference second-order perturbation principle (emb-MRPT2) based mostly on reference wavefunctions generated through embedded full energetic house self-consistent subject (emb-CASSCF) principle is at the moment state-of-the-art. However, the factorial scaling of CASSCF limits the dimensions of energetic house and the complexity of programs that may be studied. Here, we assess the efficacy of an alternate CW technique, adaptive sampling configuration interplay (ASCI)-which allows massive energetic areas to be used-for learning floor reactions.
We couple ASCI with density practical embedding principle (DFET) and benchmark its efficiency for 2 reactions: H2 desorption from and CH4 dissociation on the Cu(111) floor. Unlike embedded full energetic house second-order perturbation principle (emb-CASPT2) that precisely reproduces a measured H2 desorption barrier, embedded ASCI, utilizing a very massive energetic house (although one that also contains a small portion of the complete set of orbitals) fails to take action.
Adding an additional correlation time period from embedded Møller-Plesset second-order perturbation principle (emb-MP2) improves the desorption barrier and endothermicity predictions. Thus, the inaccuracy of embedded ASCI comes from the lacking dynamic correlation from the various different electrons and orbitals not included within the energetic house.
For CH4 dissociation, once more embedded ASCI overestimates the dissociation barrier in comparison with emb-CASPT2 predictions. Adding dynamic correlation from emb-MP2 helps appropriate the barrier. However, this composite method suffers from double counting of correlation inside embedded ASCI adopted by emb-MP2 calculations.

Anti-human CD11b Monoclonal Antibody PE Conjugated, Flow Validated

FC00144-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD11b Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD19 Monoclonal Antibody PE Conjugated, Flow Validated

FC00154-PE 25 Tests, 100 Tests, 200 Tests
EUR 108
Description: Mouse Monoclonal human CD19 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD54 Monoclonal Antibody PE Conjugated, Flow Validated

FC00171-PE 25 Tests, 100 Tests, 200 Tests
EUR 142
Description: Anti-Human CD54 Monoclonal Antibody PE Conjugated, Flow Validated

Anti-human CD38 Monoclonal Antibody PE Conjugated, Flow Validated

FC00193-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD38 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD25 Monoclonal Antibody PE Conjugated, Flow Validated

FC00214-PE 25 Tests, 100 Tests, 200 Tests
EUR 125
Description: Mouse Monoclonal human CD25 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD86 Monoclonal Antibody PE Conjugated, Flow Validated

FC00220-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Human CD86 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD4 Monoclonal Antibody PE Conjugated, Flow Validated

FC00344-PE 25 Tests, 100 Tests, 200 Tests
EUR 113
Description: Mouse Monoclonal human CD4 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD11c Monoclonal Antibody PE Conjugated, Flow Validated

FC00357-PE 25 Tests
EUR 136
Description: Mouse Monoclonal Human CD11c Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD5 Monoclonal Antibody PE Conjugated, Flow Validated

FC00480-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Anti-human CD5 PE Conjugated, designed for Flow Cytometry and validated by Flow Cytometry using Human cells.

Anti-human CD45 Monoclonal Antibody PE Conjugated, Flow Validated

FC00555-PE 25 Tests, 100 Tests, 200 Tests
EUR 118
Description: Mouse Monoclonal human CD45 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD2 Monoclonal Antibody PE Conjugated, Flow Validated

FC00570-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD2 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD71 Monoclonal Antibody PE Conjugated, Flow Validated

FC00591-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD71 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD62L Monoclonal Antibody PE Conjugated, Flow Validated

FC00652-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD62L Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD59 Monoclonal Antibody PE Conjugated, Flow Validated

FC00914-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD59 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD81 Monoclonal Antibody PE Conjugated, Flow Validated

FC01281-PE 25 Tests, 100 Tests, 200 Tests
EUR 142
Description: Mouse Monoclonal Human CD81 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD117 Monoclonal Antibody PE Conjugated, Flow Validated

FC01335-PE 25 Tests, 100 Tests, 200 Tests
EUR 143
Description: Mouse Monoclonal human CD117 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD16 Monoclonal Antibody PE Conjugated, Flow Validated

FC01408-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD16 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD32 Monoclonal Antibody PE Conjugated, Flow Validated

FC01450-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD32 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD90 Monoclonal Antibody PE Conjugated, Flow Validated

FC01818-PE 25 Tests, 100 Tests, 200 Tests
EUR 183
Description: Mouse Monoclonal human CD90 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD7 Monoclonal Antibody PE Conjugated, Flow Validated

FC01974-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD7 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD235a Monoclonal Antibody PE Conjugated, Flow Validated

FC02184-PE 25µg, 100µg
EUR 165
Description: Mouse Monoclonal human CD235a Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD8 Monoclonal Antibody PE Conjugated, Flow Validated

FC02236-PE 25 Tests, 100 Tests, 200 Tests
EUR 114
Description: Mouse Monoclonal human CD8 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD13 Monoclonal Antibody PE Conjugated, Flow Validated

FC02591-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD13 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD3 Monoclonal Antibody PE Conjugated, Flow Validated

FC02675-PE 25 Tests, 100 Tests, 200 Tests
EUR 110
Description: Mouse Monoclonal human CD3 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD20 Monoclonal Antibody PE Conjugated, Flow Validated

FC03780-PE 25 Tests, 100 Tests, 200 Tests
EUR 149
Description: Mouse Monoclonal human CD20 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD10 Monoclonal Antibody PE Conjugated, Flow Validated

FC04065-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD10 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD57 Monoclonal Antibody PE Conjugated, Flow Validated

FC09548-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD57 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human HLA-DR Monoclonal Antibody PE Conjugated, Flow Validated

FC00568-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human HLA-DR Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD55/Daf Monoclonal Antibody PE Conjugated, Flow Validated

FC00910-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD55/Daf Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human HLA-ABC Monoclonal Antibody PE Conjugated, Flow Validated

FC20056-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Human HLA-ABC Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Mouse TER-119 Monoclonal Antibody PE Conjugated, Flow Validated

FC30403-PE 25ug, 100ug
EUR 120
Description: Rat Monoclonal Mouse TER-119 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Anti-human CD33/Siglec 3 Monoclonal Antibody PE Conjugated, Flow Validated

FC01508-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD33/Siglec 3 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD3 Monoclonal Antibody PE Conjugated, Flow Validated

FC02675-PE-1 25 Tests, 100 Tests, 200 Tests
EUR 78
Description: Mouse Monoclonal Human CD3 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD3 Monoclonal Antibody PE Conjugated, Flow Validated

FC04405-4-PE 25 tests, 100 tests, 500 tests
EUR 114
Description: Mouse Monoclonal Human CD3 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Mouse CD4 Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC00344-PE-Cy7 25ug, 100ug
EUR 137
Description: Rat Monoclonal Mouse CD4 Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Anti-Human CD62L Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC00652-PE-Cy7 25tests, 100tests, 200tests
EUR 188
Description: Mouse Monoclonal Human CD62L Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD33 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC01508-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 195
Description: Mouse Monoclonal Human CD33 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Mouse Anti-human CD7 Monoclonal Antibody PE Conjugated, Flow Validated

FC01974-1-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Mouse human CD7 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD3 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC02675-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 160
Description: Mouse Monoclonal Human CD3 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD10 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC04065-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 166
Description: Mouse Monoclonal human CD10 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human/Mouse CD45R (B220) Monoclonal Antibody PE Conjugated, Flow Validated

FC00555-2-PE 25ug, 100ug
EUR 96
Description: Rat Monoclonal Human/Mouse CD45R (B220) Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human, Mouse.

Anti-Human HLA-DR Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC01340-PE-Cy7 25tests, 100tests, 200tests
EUR 188
Description: Anti-Human HLA-DR Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

Mouse IgG-PE conjugate (isotype control)

20008-PE 50 Tests
EUR 164

Rabbit IgG-PE conjugate (isotype control)

20009-PE 100 tests
EUR 225

Goat IgG-PE conjugate (isotype control)

20011-PE 100 tests
EUR 225

Monoclonal Anti-Rat IgG1-PE Conjugate

50126-PE 0.1 ml
EUR 347

Anti-Mouse CD4 Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC00344-2-PE-Cy7 25ug, 100ug
EUR 131
Description: Rat Monoclonal Mouse CD4 Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Rat IgG-PE conjugate (isotype control) (Isotype control)

20005-PE 25 tests
EUR 202

Mouse Monoclonal Anti-Human IgG1 (Fc-region)-PE (phycoerythrin) conjugate

10121-PE 0.5 ml
EUR 408

Mouse Monoclonal Anti-Human IgG2 (Fc-region)-PE (phycoerythrin) conjugate

10122-PE 0.5 ml
EUR 408

Mouse Monoclonal Anti-Human IgG3 (Hinge-region)-PE (phycoerythrin) conjugate

10123-PE 0.5 ml
EUR 408

Mouse Monoclonal Anti-Human IgG4 (Fc-region)-PE (phycoerythrin) conjugate

10124-PE 0.5 ml
EUR 408

Mouse Monoclonal Anti-Human CD59, (PE) (Clone 1F5) (mouse IgG1)

CD59-PE 25 tests
EUR 408

Rat Monoclonal Anti-Mouse CD25 , PE (Clone PC61.5.3) (rat IgG1)

MCD025-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD34, PE (Clone MEC14.7) (rat IgG2a)

MCD034-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD44, PE (Clone KM81) (rat IgG2a)

MCD044-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD45RB, PE (Clone 16A) (rat IgG2a)

MCD045RB-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD117 , PE (Clone ACK4) (rat IgG2a)

MCD117-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD147, PE (Clone OX114) (rat IgG1)

MCD147-PE 50 tests
EUR 347

Rat Monoclonal Anti-Mouse CD157, PE (Clone KT157) (Rat IgG2c)

MCD157-PE 50 tests
EUR 347

Rat Monoclonal Anti-Mouse CD200, PE (Clone OX90) (rat IgG2a)

MCD200-PE 50 tests
EUR 347

Rat Monoclonal Anti-Mouse CD200R, PE (Clone OX110) (rat IgG2a)

MCD200R-PE 50 tests
EUR 347

Mouse Monoclonal Anti-Rat CD8b PE (Clone 3.4.1 ) (mouse IgG1 )

RCD008B-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD134, PE (Clone OX40) (mouse IgG2b)

RCD134-PE 100 tests
EUR 469

Hamster Mono Anti-Mouse CD3z, PE (Clone H146-968) (hamster IgG)

MCD003Z-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD4 PE (Clone CT-CD4) (rat IgG2a)

MCD004-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Mouse CD11a, PE (Clone 8-6.2) (mouse IgG2a)

MCD011A-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD11b, PE (Clone M1/70.15) (rat IgG2b)

MCD011B-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD40, PE (Clone 3/23) (rat IgG2b)

MCD040-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD45RC, PE (Clone IBL-8) (rat IgG1)

MCD045RC-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD49d, PE (Clone R1-2) (rat IgG2b)

MCD049D-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD62L, PE (Clone MEL-14) (rat IgG2a)

MCD062L-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Mouse CD72.1, PE (Clone CT-72.1) (mouse IgG2a)

MCD072-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD80 , PE (Clone RMMP-1) (rat IgG2a)

MCD080-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Mouse/Rat CD81, PE (Clone Eat2)(mouse IgG1)

MCD081-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD86, PE (Clone RMMP-2) (rat IgG2a)

MCD086-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD90, PE (Clone IBL-1) (rat IgG1)

MCD0902-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD94, PE, (clone: 15F.18D1), (rat IgG1k)

MCD094-PE 50 tests
EUR 347

Rat Monoclonal Anti-Mouse CD134, PE (Clone OX-86)(rat IgG1)

MCD134-PE 100 tests
EUR 469

Rat Monoclonal Anti-Mouse CD134L/OX40L, PE (Clone OX89) (rat IgG1)

MCD134L-PE 50 tests
EUR 347

Mouse Monoclonal Anti-Rat CD2 PE (Clone OX-34) (mouse IgG2a)

RCD002-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD4 PE (Clone W3/25) (mouse IgG1)

RCD004-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD5 PE (Clone OX-19) (mouse IgG1)

RCD005-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD8a PE (Clone OX-8) (mouse IgG1)

RCD008A-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD11a PE (Clone WT.1) (mouse IgG2a)

RCD011A-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD18 PE (Clone WT.3) (mouse IgG1)

RCD018-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD25 PE (Clone OX-39) (mouse IgG1)

RCD025-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD26 PE (Clone OX-61) (mouse IgG2a)

RCD026-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD43 PE (Clone W3/13HLK) (mouse IgG1)

RCD043-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD45 PE (Clone OX-30) (mouse IgG2a)

RCD045-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD45RC PE (Clone OX-22) (mouse IgG1)

RCD045RC-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD48 PE (Clone OX-45) (mouse IgG1)

RCD048-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD62L PE (Clone OX-85)(mouse IgG1)

RCD062L-PE 100 tests
EUR 469

Mouse Monoclonal Anti-Rat CD152 PE (Clone WKH 203 ) (mouse IgG1 )

RCD152-PE 100 tests
EUR 469

Mouse IgG1-PE conjugate (isotype control)

20102-101-PE 50 Tests
EUR 164

Mouse IgG2a-PE conjugate (isotype control)

20102-102-PE 50 Tests
EUR 164

Mouse IgG2b-PE conjugate (isotype control)

20102-103-PE 50 Tests
EUR 164

Mouse IgG3-PE conjugate (isotype control)

20102-104-PE 50 Tests
EUR 202

Mouse IgM-PE conjugate (isotype control)

20102-105-PE 50 Tests
EUR 202

Anti-CD4 Antibody [OKT4], PE-100Tests

QAB11-PE-100Tests 100Tests
EUR 166

Anti-CD4 Antibody [OKT4], PE-25Tests

QAB11-PE-25Tests 25Tests
EUR 123

Anti-CD4 Antibody [OKT4], PE-500Tests

QAB11-PE-500Tests 500Tests
EUR 505

Anti-CD5 Antibody [UCHT2], PE-100Tests

QAB15-PE-100Tests 100Tests
EUR 225

Anti-CD5 Antibody [UCHT2], PE-25Tests

QAB15-PE-25Tests 25Tests
EUR 141

Anti-CD8a Antibody [OKT8], PE-100Tests

QAB17-PE-100Tests 100Tests
EUR 225

Anti-CD8a Antibody [OKT8], PE-25Tests

QAB17-PE-25Tests 25Tests
EUR 141

Anti-CD8a Antibody [OKT8], PE-500Tests

QAB17-PE-500Tests 500Tests
EUR 758

Anti-CD8 Antibody [SK1], PE-100Tests

QAB18-PE-100Tests 100Tests
EUR 436

Anti-CD8 Antibody [SK1], PE-25Tests

QAB18-PE-25Tests 25Tests
EUR 216

Anti-CD8 Antibody [SK1], PE-500Tests

QAB18-PE-500Tests 500Tests
EUR 1739

Anti-CD11c Antibody [N418], PE-100ug

QAB23-PE-100ug 100ug
EUR 225

Anti-CD11c Antibody [N418], PE-25ug

QAB23-PE-25ug 25ug
EUR 123

Anti-CD11c Antibody [3.9], PE-100Tests

QAB24-PE-100Tests 100Tests
EUR 233

Anti-CD11c Antibody [3.9], PE-25Tests

QAB24-PE-25Tests 25Tests
EUR 131

Anti-CD11b Antibody [ICRF44], PE-100Tests

QAB25-PE-100Tests 100Tests
EUR 225

Anti-CD11b Antibody [ICRF44], PE-25Tests

QAB25-PE-25Tests 25Tests
EUR 141

Anti-CD14 Antibody [61D3], PE-100Tests

QAB26-PE-100Tests 100Tests
EUR 251

Anti-CD14 Antibody [61D3], PE-25Tests

QAB26-PE-25Tests 25Tests
EUR 157

Anti-Foxp3 Antibody [MF23], PE-100ug

QAB27-PE-100ug 100ug
EUR 369

Anti-Foxp3 Antibody [MF23], PE-25ug

QAB27-PE-25ug 25ug
EUR 200

Anti-CD19 Antibody [1D3], PE-100ug

QAB28-PE-100ug 100ug
EUR 166

Anti-CD19 Antibody [1D3], PE-25ug

QAB28-PE-25ug 25ug
EUR 131

Anti-CD19 Antibody [SJ25C1], PE-100Tests

QAB29-PE-100Tests 100Tests
EUR 225

Anti-CD19 Antibody [SJ25C1], PE-25Tests

QAB29-PE-25Tests 25Tests
EUR 131

Anti-CD19 Antibody [SJ25C1], PE-500Tests

QAB29-PE-500Tests 500Tests
EUR 749

Anti-CD3 Antibody [17A2], PE-100ug

QAB3-PE-100ug 100ug
EUR 200

Anti-CD3 Antibody [17A2], PE-25ug

QAB3-PE-25ug 25ug
EUR 131

Anti-CD19 Antibody [HIB19], PE-100Tests

QAB30-PE-100Tests 100Tests
EUR 166

Anti-CD19 Antibody [HIB19], PE-25Tests

QAB30-PE-25Tests 25Tests
EUR 115

Anti-CD20 Antibody [2H7], PE-100Tests

QAB31-PE-100Tests 100Tests
EUR 293

Anti-CD20 Antibody [2H7], PE-25Tests

QAB31-PE-25Tests 25Tests
EUR 182

Anti-CD20 Antibody [2H7], PE-500Tests

QAB31-PE-500Tests 500Tests
EUR 1046

Anti-CD25 Antibody [PC61.5], PE-100ug

QAB34-PE-100ug 100ug
EUR 225

Anti-CD25 Antibody [PC61.5], PE-25ug

QAB34-PE-25ug 25ug
EUR 123

Anti-CD25 Antibody [PC61.5], PE-500ug

QAB34-PE-500ug 500ug
EUR 530

Anti-CD25 Antibody [BC96], PE-100Tests

QAB35-PE-100Tests 100Tests
EUR 200

Anti-CD25 Antibody [BC96], PE-25Tests

QAB35-PE-25Tests 25Tests
EUR 131

Anti-CD27 Antibody [O323], PE-100Tests

QAB36-PE-100Tests 100Tests
EUR 216

Anti-CD27 Antibody [O323], PE-25Tests

QAB36-PE-25Tests 25Tests
EUR 131

Anti-CD28 Antibody [CD28.2], PE-100Tests

QAB37-PE-100Tests 100Tests
EUR 225

Anti-CD28 Antibody [CD28.2], PE-25Tests

QAB37-PE-25Tests 25Tests
EUR 141

Anti-CD38 Antibody [HIT2], PE-100Tests

QAB38-PE-100Tests 100Tests
EUR 225

Anti-CD38 Antibody [HIT2], PE-25Tests

QAB38-PE-25Tests 25Tests
EUR 141

Anti-CD3 Antibody [SK7], PE-100Tests

QAB4-PE-100Tests 100Tests
EUR 411

Anti-CD3 Antibody [SK7], PE-25Tests

QAB4-PE-25Tests 25Tests
EUR 216

Anti-CD45.1 Antibody [A20], PE-100ug

QAB42-PE-100ug 100ug
EUR 208
We subsequently conclude that the state-of-the-art emb-MRPT2 based mostly on reference wavefunctions generated through emb-CASSCF stays the tactic of alternative for learning floor reactions. emb-ASCI is helpful when massive energetic areas past the restrict of emb-CASSCF are important, resembling to review complicated floor reactions with vital multiconfigurational character (static correlation) however weak dynamic correlation.

Three Novel Entomopathogenic Fungi From China and Thailand

Entomopathogenic fungi are ubiquitous in tropical rainforests and function a excessive stage of range. This group of fungi not solely has necessary ecological worth but in addition medicinal worth. Nevertheless, they’re typically ignored, and many unknown species have but to be found and described. The current examine goals to contribute to the taxonomical and phylogenetic understanding of the genus Paraisaria by describing three new species collected from Guizhou and Yunnan Provinces in China and Krabi Province in Thailand.
The three novel species named Paraisaria alba, P. arcta, and P. rosea share comparable morphologies as these within the genus Paraisaria, containing solitary, easy, fleshy stroma, fully immersed perithecia and cylindrical asci with thickened caps and filiform ascospores that usually disarticulate at maturity. Phylogenetic analyses of mixed LSU, SSU, TEF1-α, RPB1, RPB2, and ITS sequence knowledge verify their placement within the genus Paraisaria. In this examine, the three entomopathogenic taxa are comprehensively described with colour images and phylogenetic analyses. A synopsis desk and a key to all handled species of Paraisaria are additionally included.

First report of alfalfa leaf spot brought on by Leptosphaerulina australis in China

A illness was noticed on alfalfa cultivar WL168 characterised by white to brown leaf spots of normal to spherical shapes, in Aluhorqin County, Inner Mongolia, China (120°13’23″ to 120°29’14″ E, 43°27’52″to 43°35’16″ N, 281.71m to360.13 m Altitude) throughout 2019 to 2020. The illness primarily offered in spring one month after re-greening and the incidence was 78.30% on this discipline.
Twenty alfalfa vegetation with extreme signs had been used for pathogen isolation. The contaminated tissue was reduce into 2 × 2 mm items, surface-sterilized (in 75% ethanol and 5% business bleach (NaClO) for 30 s and 2 min, respectively), rinsed 5 occasions with sterilized distilled water, and dried between sterile filter paper (Wang et al. 2019). The diseased tissue from every plant pattern had been cultured on potato dextrose agar (PDA) and incubated at 25 °C with 12 h mild/day for ten days.
A fungus was remoted from the diseased leaves at a 100% frequency. Fungal development on PDA was spherical with a black floor, radial edge, and a unclean white middle. The ascocarps had been moved to a clear microscope slide to launch asci and ascospores. Ascocarps had been spheroidal, subglobose brown, 120 to 160 µm × 160 to 180 µm, which include a number of ascus. The dimension of ascus had been to 41.6 μm × to 87.5 μm and every asci having eight ascospores.
Ascospores had been ellipsoid to rectangular with a gelatinous sheath, brown, 8.Eight to µm × 29.9 to µm with 2 to three horizontal septums, and zero to 2 vertical septums. A phylogenetic tree was constructed after DNA extraction, PCR with primers to amplify the ITS (VG9: 5′- TTACGTCCCTGCCCTTTGTA-3′ and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′) and LSU (LR7: 5′-TACTACCACCAAGATCT-3′ and LROR: 5′- GTACCCGCTGA ACTTAAGC -3′) areas. The LSU (SUB8273071) and ITS (SUB8218291) amplicons confirmed 99% similarity with L. australis (EU754166.1) within the GenBank.
To confirm the pathogenicity, fungs plugs had been inverted on three compound leaves of 20 alfalfa WL168 for 2 days. Agar plugs (PDA) had been inverted on one other 20 alfalfa WL168 three compound leaves which had been management. All vegetation had been maintained at 22 °C and 44% relative humidity in a development chamber. Similar illness signs had been noticed on contaminated leaves ten days after inoculation, whereas management vegetation confirmed no signs.
The similar fungus was re-isolated from the lesions, and additional morphological characterization and molecular assays, as described above. L. australis has been reported on numerous vegetation, together with Prunusarmeniaca, Dolichos, Poa, Lolium, and Vitis in Australia (Graham and Luttrell., 1961), and additionally from Korean soil in 2018 (Weilan et al., 2018). Additionally, L. briosiana, which is frequent within the USA, China, and different nations, causes Leptosphaerulina leaf spot (Samacet al., 2015). L. trifolii is newly reported to happen in China (Liu et al., 2019). To one of the best of our information, that is the primary report of L. australis infecting alfalfa in China. Considering the big planting space in Inner Mongolia, this pathogen might losses to alfalfa cultivation. Hence, future research ought to discover points of efficient administration of this illness.

Four new species of Talaromyces part Talaromyces found in China

Four new Talaromyces species with none shut kinfolk are reported right here, specifically, T. aureolinus (ex-type AS3.15865 T), T. bannicus (ex-type AS3.15862 T), T. penicillioides (ex-type AS3.15822 T), and T. sparsus (ex-type AS3.16003 T). Morphologically, T. aureolinus is exclusive in producing orange-yellow mycelium and gymnothecia, singly borne asci, and ellipsoidal, spiny ascospores.
Three Novel Entomopathogenic Fungi From China and Thailand
 Talaromyces bannicus is characterised by the sluggish development price, polymorphic conidiophores, inconsistent stipe lengths, and pyriform to ellipsoidal, echinulate conidia. Talaromyces penicillioides is distinguished by good development and sporulation on malt extract agar (MEA) and yeast extract sucrose agar (YES) media, resembling the colony appearances of sure Penicillium species, and appressed biverticillate and sometimes monoverticillate penicilli bearing globose to ellipsoidal, echinulate conidia.

FSCN1 antibody

70R-17358 50 ul
EUR 435
Description: Rabbit polyclonal FSCN1 antibody

FSCN1 Antibody

DF7988 200ul
EUR 304
Description: FSCN1 Antibody detects endogenous levels of total FSCN1.

FSCN1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

FSCN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FSCN1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FSCN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

FSCN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

FSCN1 Conjugated Antibody

C35636 100ul
EUR 397

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Fascin (Fscn1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx032965-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx032965-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx432714-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx233018-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

FSCN1 Monoclonal Antibody

EUR 300

Anti-FSCN1 antibody

STJ71472 100 µg
EUR 359

Anti-FSCN1 antibody

STJ23712 100 µl
EUR 413
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ27695 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ115318 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Fscn1/ Rat Fscn1 ELISA Kit

ELI-05701r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 Polyclonal Conjugated Antibody

C30401 100ul
EUR 397

Fascin (FSCN1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FSCN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FSCN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FSCN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Fascin/FSCN1 Antibody

PB9592 100ug/vial
EUR 294

Anti-Fascin/FSCN1 Antibody

PA1575 100ug/vial
EUR 294

FSCN1 Rabbit pAb

A5867-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb

A5867-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb

A5867-20ul 20 ul Ask for price

FSCN1 Rabbit pAb

A5867-50ul 50 ul Ask for price

FSCN1 Rabbit pAb

A13355-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb

A13355-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb

A13355-20ul 20 ul
EUR 183

FSCN1 Rabbit pAb

A13355-50ul 50 ul
EUR 223

Fscn1 Blocking Peptide

33R-9865 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fscn1 antibody, catalog no. 70R-8641

FSCN1 Blocking Peptide

DF7988-BP 1mg
EUR 195

FSCN1 cloning plasmid

CSB-CL619084HU-10ug 10ug
EUR 524
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atgaccgccaacggcacagccgaggcggtgcagatccagttcggcctcatcaactgcggcaacaagtacctgacggccgaggcgttcgggttcaaggtgaacgcgtccgccagcagcctgaagaagaagcagatctggacgctggagcagccccctgacgaggcgggcagcgcgg
  • Show more
Description: A cloning plasmid for the FSCN1 gene.

Polyclonal FSCN1 Antibody (internal region)

APR16037G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FSCN1 (internal region). This antibody is tested and proven to work in the following applications:

Fascin-1(FSCN1/416) Antibody

BNC610416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC610416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC610417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC610417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC610418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC610418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC680416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC680416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC680417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC680417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC680418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC680418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC400416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC400416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC400417-100 100uL