Molecular data reveals a new holomorphic marine fungus, Halobyssothecium estuariae, and the asexual morph of Keissleriella phragmiticola

This examine introduces a novel holomorphic marine fungal species, Halobyssothecium estuariae (Lentitheciaceae, Pleosporales), from lifeless Phragmites communis. The new species has semi-immersed, subglobose or ellipsoidal, papillate, conical ascomata, clavate to subcylindrical, quick pedicellate asci and 3-septate, fusoid to ellipsoidal ascospores with rounded ends, pale brown to darkish brown central cells and hyaline finish cells.
The asexual morph has multiseptate, filiform, intercalary, catenate, branched chlamydospores that resemble Xylomyces. The asexual morph of Keissleriella phragmiticola based mostly on mixed LSU, SSU, ITS and TEF1 sequence analyses is reported. The function of molecular identification in delineating cryptic species are additionally mentioned.

First report of Colletotrichum fructicola inflicting anthracnose on Pouteria campechiana in China

Pouteria campechiana (Kunth) Baehni (=Lucuma nervosa A. DC.) is a fruit crop planted in southern China (Gao et al. 2019). It is initially from Central America, and additionally grown there commercially in addition to in some American states (Fadzilah et al. 2018). In March 2019, a leaf spot illness was discovered on P. campechiana in Baoshan, Yunnan, China. Field surveys have been completed in a 0.06 ha orchard in Yunnan Province. Leaf spots have been discovered on 90% of six-year-old vegetation on this subject and have been noticed in different planting areas. The signs initially appeared as small, spherical, brown spots. As the illness developed, the heart of the lesions was sunken with a darkish brown border (Fig. 1).
Under extreme situations, some spots have been joined into bigger irregular spots, and even complete leaves died. The illness severity of completely different vegetation diversified, and some leaves confirmed solely a few brown spots whereas others confirmed many spots. Small fragments of diseased tissues (3×Three mm) have been disinfected in 75% ethanol for 10 s, 1% NaClO for 1 min, and rinsed 3 times in sterilized water.
Then, tissues have been positioned onto potato dextrose agar (PDA), and incubated at 25°C in the darkish for five days. Fungal isolates with comparable morphology have been persistently recovered from diseased tissues. The 25 colonies have been initially cottony, pale white to pale grey on the higher facet and greyish-green with black zonation on the underside of plates.
Conidia have been single-celled and hyaline, aseptate, straight, and cylindrical, with rounded ends (Fig. 1B). The size and width of 200 conidia have been measured for 2 consultant isolates, DHG-1 and DHG-2, and these averaged 14.48 × 5.59 μm and 14.92 × 5.57 μm. Appressoria have been ovoid, generally clavate, brown, averaged 7.47 × 5.86 μm and 7.25 × 5.85 μm (n=30). Brown and globose ascocarp have been noticed on the leaves of Pouteria campechiana.
 Asci have been unitunicate, thin-walled, 6-Eight spored, clavate, averaged 51.53×13.01 μm and 50.21 × 13.32 μm (n=30). Ascospores have been hyaline, one-celled, barely curved to curved with obtuse to barely rounded ends, averaged 14.64×5.97 μm and 15.19 × 6.23 μm (n=30). These two isolates have been chosen for molecular identification. DNA was extracted from mycelia with the DNA safe Plant Kit (TIANGEN, Biotech, China).
For additional molecular identification, the inside transcribed spacer (ITS), partial actin (ACT), calmodulin (CAL), chitin synthase (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), beta-tubulin (TUB2), and the Apn2-Mat1-2 intergenic spacer and partial mating kind (Mat1-2) gene (ApMat) genes of the strains (DHG-1, DHG-2) have been amplified utilizing the primer pairs ITS1/ITS4, ACT-512F/ACT-783R, CL1C/CL2C, CHS-79F/CHS-345R, GDF1/GDR1, T1/Bt-2b, and AM-F/AM-R (Weir et al. 2012; Silva et al. 2012), respectively.
The sequences have been obtained and in contrast with GenBank and all of them confirmed over 99% id to the kind pressure of Colletotrichum fructicola ICMP 18581 (Accession nos. JX010165, JX010033, JQ807838, FJ907426, JX010405, JX009866, and FJ917508) (Weir et al. 2012). A phylogenetic tree based mostly on the mixed ITS, ACT, CAL, CHS-1, TUB2, GAPDH and ApMat sequences utilizing the Neighbor-joining algorithm revealed that the isolates have been C. fructicola (Fig. 2). The sequences have been deposited into GenBank with accession MN955541, MN955542, and MN966581 to MN966592.
 Molecular data reveals a new holomorphic marine fungus, Halobyssothecium estuariae, and the asexual morph of Keissleriella phragmiticola
Pathogenicity assessments have been carried out on eighteen wholesome and tender leaves of six 1-year-old P. campechiana vegetation in a greenhouse. The experiment was repeated twice. The size and width of the inoculated leaves have been between 8-13 cm × 2.5-3.6 cm. The dermis of every examined leaf was evenly scratched in six separate areas with a sterilized needle. Each isolate was inoculated onto at the very least three wounded leaves by inserting 20 μL of a conidial suspension (106 conidia/mL) on the wound websites. Control leaves have been additionally wounded and inoculated with distilled water.
All the vegetation have been then sprayed with distilled water and lined with plastic luggage. After 10 days, preliminary signs appeared as round and deep yellow spots. After a few extra days, the spots grew to become brown, enlarged to as much as 4.Zero mm which was much like signs noticed in the subject, whereas controls remained symptomless. Koch’s postulates have been fulfilled by re-isolation of C. fructicola from diseased leaves, and identification confirmed by sequencing.
Colletotrichum fructicola has been related to anthracnose on mango, apple, pear and cassava (Oliveira et al. 2018). To our data, that is the first report of C. fructicola related to anthracnose of P. campechiana worldwide. These outcomes will present essential info for future epidemiological research and for administration of this illness.

FgPal1 regulates morphogenesis and pathogenesis in Fusarium graminearum

Ascospores are the main inoculum in Fusarium graminearum, a causal agent of wheat head blight. In a earlier examine, FgPAL1 was discovered to be up-regulated in the Fgama1 mutant and vital for ascosporogenesis. However, the organic operate of this well-conserved gene in filamentous ascomycetes isn’t clear. In this examine, we characterised its capabilities in progress, differentiation, and pathogenesis. The Fgpal1 mutant had extreme progress defects and typically displayed irregular hyphal ideas.
It was faulty in infectious progress in rachis tissues and spreading in wheat heads. The Fgpal1 mutant produced conidia with fewer septa and extra nuclei per compartment than the wild kind. In actively rising hyphal ideas, FgPal1-GFP primarily localized to the subapical collar and septa. The FgPal1 and LifeAct partially co-localized at the subapical area in the interdependent method.

Tenascin C Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tenascin (TN-C) Antibody

EUR 349

Tenascin (TN-C) Antibody

EUR 146

Tenascin-C Polyclonal Antibody

41914-100ul 100ul
EUR 252

Tenascin-C Polyclonal Antibody

41914-50ul 50ul
EUR 187

Tenascin C (TNC) Antibody

abx219024-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Tenascin C (TNC) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tenascin C (TNC) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tenascin C (TNC) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tenascin C (TNC) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tenascin C (TNC) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tenascin C (TNC) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tenascin C (TNC) Antibody

  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tenascin C Conjugated Antibody

C48835 100ul
EUR 397

Tenascin C (TNC) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin C (TNC) Antibody

abx433386-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Tenascin-C Polyclonal Antibody

ABP53279-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Tenascin-C
  • Applications tips:
Description: A polyclonal antibody for detection of Tenascin-C from Human, Mouse, Rat. This Tenascin-C antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Tenascin-C

Tenascin-C Polyclonal Antibody

ABP53279-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Tenascin-C
  • Applications tips:
Description: A polyclonal antibody for detection of Tenascin-C from Human, Mouse, Rat. This Tenascin-C antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Tenascin-C

Tenascin-C Polyclonal Antibody

ABP53279-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Tenascin-C
  • Applications tips:
Description: A polyclonal antibody for detection of Tenascin-C from Human, Mouse, Rat. This Tenascin-C antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Tenascin-C

Anti-Tenascin C Antibody

EUR 479

Tenascin-C Polyclonal Antibody

ES4278-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Tenascin-C from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Tenascin-C Polyclonal Antibody

ES4278-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Tenascin-C from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-Tenascin-C antibody

STJ16100797 100 µg
EUR 557

Anti-Tenascin-C antibody

STJ16100798 100 µg
EUR 557

Anti-Tenascin-C antibody

STJ16101005 100 µg
EUR 354

Anti-Tenascin-C antibody

STJ97243 200 µl
EUR 197
Description: Rabbit polyclonal to Tenascin-C.

anti-Tenascin C

YF-PA23936 50 ul
EUR 334
Description: Mouse polyclonal to Tenascin C

Tenascin antibody

70R-14232 100 ug
EUR 322
Description: Affinity purified Mouse polyclonal Tenascin antibody

Tenascin antibody

70R-15292 100 ug
EUR 327
Description: Rabbit polyclonal Tenascin antibody

Tenascin antibody

10R-T103a 100 ug
EUR 476
Description: Mouse monoclonal Tenascin antibody

Tenascin antibody

10R-7904 100 ug
EUR 322
Description: Mouse monoclonal Tenascin antibody

Tenascin C (Stromal Marker For Epithelial Malignancy); Clone T2H5 (Concentrate)

RA0135-C.1 0.1 ml
EUR 125

Tenascin C (Stromal Marker For Epithelial Malignancy); Clone T2H5 (Concentrate)

RA0135-C.5 0.5 ml
EUR 247

Tenascin C (TNC) Antibody Pair

abx117625-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Polyclonal Tenascin (TN-C) Antibody

APR13724G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tenascin (TN-C) . This antibody is tested and proven to work in the following applications:

Tenascin-C Polyclonal Conjugated Antibody

C41914 100ul
EUR 397

Tenascin C (TNC) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Tenascin C (TNC) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Anti-Tenascin C/TNC Antibody

PA2055 100ug/vial
EUR 334

Tenascin C Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Tenascin C Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Recombinant human Tenascin-C

P1634 100ug Ask for price
  • Uniprot ID: Q99857
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Tenascin-C

Recombinant Tenascin C (TNC)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P24821
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.8kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Tenascin C expressed in: E.coli

Recombinant Tenascin C (TNC)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q80YX1
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.9kDa
  • Isoelectric Point: 4.6
Description: Recombinant Mouse Tenascin C expressed in: E.coli

Recombinant Tenascin C (TNC)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: B2LYI9
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 12.6kDa
  • Isoelectric Point: 5.1
Description: Recombinant Rat Tenascin C expressed in: E.coli

Recombinant Tenascin C (TNC)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: B2LYI9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Tenascin C expressed in: E.coli

Recombinant Tenascin C (TNC)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: B2LYI9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.5kDa
  • Isoelectric Point: 4.3
Description: Recombinant Rat Tenascin C expressed in: E.coli

Anti-Tenascin C (3B4)

YF-MA13620 100 ug
EUR 363
Description: Mouse monoclonal to Tenascin C

Polyclonal TNC / Tenascin C Antibody (C-Terminus)

APR13764G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNC / Tenascin C (C-Terminus). This antibody is tested and proven to work in the following applications:

Tenascin C (TNC) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNC (Val49~Lys181)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tenascin C (TNC)

Tenascin C (TNC) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNC (Cys174~Ser621)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tenascin C (TNC)

Tenascin C (TNC) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNC (Asp513~Ser621)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tenascin C (TNC)

Tenascin C (TNC) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNC (Cys356~Asp495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tenascin C (TNC)

Tenascin C (TNC) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNC (Val175~Gly342)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tenascin C (TNC)

Tenascin C (TNC) Monoclonal Antibody (Human)

  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val49~Lys181
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Tenascin C (TNC)

Anti-Tenascin C Rabbit Monoclonal Antibody

M00936-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Tenascin C Antibody. Validated in WB and tested in Human.

Tenascin antibody (HRP)

60R-1711 100 ug
EUR 327
Description: Rabbit polyclonal Tenascin antibody (HRP)

Tenascin antibody (FITC)

60R-1712 100 ug
EUR 327
Description: Rabbit polyclonal Tenascin antibody (FITC)

Tenascin antibody (biotin)

60R-1713 100 ug
EUR 327
Description: Rabbit polyclonal Tenascin antibody (biotin)

Tenascin Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin (TNC) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin (TNC) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenascin (TNC) Antibody

abx140268-01mg 0.1 mg
EUR 384
  • Shipped within 5-12 working days.

Tenascin-X Antibody

abx238596-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tenascin(T2H5) Antibody

BNUB0392-100 100uL
EUR 209
Description: Primary antibody against Tenascin(T2H5), Concentration: 0.2mg/mL

Tenascin(T2H5) Antibody

BNUB0392-500 500uL
EUR 458
Description: Primary antibody against Tenascin(T2H5), Concentration: 0.2mg/mL

Tenascin(T2H5) Antibody

BNUM0392-50 50uL
EUR 395
Description: Primary antibody against Tenascin(T2H5), 1mg/mL

Tenascin(T2H5) Antibody

BNC040392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF405S conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC040392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF405S conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC610392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF660R conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC610392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF660R conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC470392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF647 conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC470392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF647 conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC550392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF555 conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC550392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF555 conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC050392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF405M conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC050392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF405M conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC400392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF640R conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC400392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF640R conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC430392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF543 conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC430392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF543 conjugate, Concentration: 0.1mg/mL

Tenascin (TNC) Antibody

abx411626-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Tenascin(T2H5) Antibody

BNC800392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF680 conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC800392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF680 conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC810392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), CF680R conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNC810392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), CF680R conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNCP0392-250 250uL
EUR 383
Description: Primary antibody against Tenascin(T2H5), PerCP conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNCR0392-250 250uL
EUR 383
Description: Primary antibody against Tenascin(T2H5), RPE conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNCA0392-250 250uL
EUR 383
Description: Primary antibody against Tenascin(T2H5), APC conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNCAP0392-100 100uL
EUR 199
Description: Primary antibody against Tenascin(T2H5), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Tenascin(T2H5) Antibody

BNCAP0392-500 500uL
EUR 544
Description: Primary antibody against Tenascin(T2H5), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
The Fgpal1 mutant was regular in meiosis with eight nuclei in creating asci however most asci have been aborted. Taken collectively, our outcomes confirmed that FgPal1 performs a function in sustaining polarized tip progress and coordination between nuclear division and cytokinesis, and additionally it is vital for infectious progress and developments of ascospores by the free cell formation course of. This article is protected by copyright. All rights reserved.

Three Novel Entomopathogenic Fungi From China and Thailand

Entomopathogenic fungi are ubiquitous in tropical rainforests and function a excessive stage of range. This group of fungi not solely has necessary ecological worth but in addition medicinal worth. Nevertheless, they’re typically ignored, and many unknown species have but to be found and described. The current examine goals to contribute to the taxonomical and phylogenetic understanding of the genus Paraisaria by describing three new species collected from Guizhou and Yunnan Provinces in China and Krabi Province in Thailand.
The three novel species named Paraisaria alba, P. arcta, and P. rosea share comparable morphologies as these within the genus Paraisaria, containing solitary, easy, fleshy stroma, fully immersed perithecia and cylindrical asci with thickened caps and filiform ascospores that usually disarticulate at maturity. Phylogenetic analyses of mixed LSU, SSU, TEF1-α, RPB1, RPB2, and ITS sequence knowledge verify their placement within the genus Paraisaria. In this examine, the three entomopathogenic taxa are comprehensively described with colour images and phylogenetic analyses. A synopsis desk and a key to all handled species of Paraisaria are additionally included.

First report of alfalfa leaf spot brought on by Leptosphaerulina australis in China

A illness was noticed on alfalfa cultivar WL168 characterised by white to brown leaf spots of normal to spherical shapes, in Aluhorqin County, Inner Mongolia, China (120°13’23″ to 120°29’14″ E, 43°27’52″to 43°35’16″ N, 281.71m to360.13 m Altitude) throughout 2019 to 2020. The illness primarily offered in spring one month after re-greening and the incidence was 78.30% on this discipline.
Twenty alfalfa vegetation with extreme signs had been used for pathogen isolation. The contaminated tissue was reduce into 2 × 2 mm items, surface-sterilized (in 75% ethanol and 5% business bleach (NaClO) for 30 s and 2 min, respectively), rinsed 5 occasions with sterilized distilled water, and dried between sterile filter paper (Wang et al. 2019). The diseased tissue from every plant pattern had been cultured on potato dextrose agar (PDA) and incubated at 25 °C with 12 h mild/day for ten days.
A fungus was remoted from the diseased leaves at a 100% frequency. Fungal development on PDA was spherical with a black floor, radial edge, and a unclean white middle. The ascocarps had been moved to a clear microscope slide to launch asci and ascospores. Ascocarps had been spheroidal, subglobose brown, 120 to 160 µm × 160 to 180 µm, which include a number of ascus. The dimension of ascus had been to 41.6 μm × to 87.5 μm and every asci having eight ascospores.
Ascospores had been ellipsoid to rectangular with a gelatinous sheath, brown, 8.Eight to µm × 29.9 to µm with 2 to three horizontal septums, and zero to 2 vertical septums. A phylogenetic tree was constructed after DNA extraction, PCR with primers to amplify the ITS (VG9: 5′- TTACGTCCCTGCCCTTTGTA-3′ and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′) and LSU (LR7: 5′-TACTACCACCAAGATCT-3′ and LROR: 5′- GTACCCGCTGA ACTTAAGC -3′) areas. The LSU (SUB8273071) and ITS (SUB8218291) amplicons confirmed 99% similarity with L. australis (EU754166.1) within the GenBank.
To confirm the pathogenicity, fungs plugs had been inverted on three compound leaves of 20 alfalfa WL168 for 2 days. Agar plugs (PDA) had been inverted on one other 20 alfalfa WL168 three compound leaves which had been management. All vegetation had been maintained at 22 °C and 44% relative humidity in a development chamber. Similar illness signs had been noticed on contaminated leaves ten days after inoculation, whereas management vegetation confirmed no signs.
The similar fungus was re-isolated from the lesions, and additional morphological characterization and molecular assays, as described above. L. australis has been reported on numerous vegetation, together with Prunusarmeniaca, Dolichos, Poa, Lolium, and Vitis in Australia (Graham and Luttrell., 1961), and additionally from Korean soil in 2018 (Weilan et al., 2018). Additionally, L. briosiana, which is frequent within the USA, China, and different nations, causes Leptosphaerulina leaf spot (Samacet al., 2015). L. trifolii is newly reported to happen in China (Liu et al., 2019). To one of the best of our information, that is the primary report of L. australis infecting alfalfa in China. Considering the big planting space in Inner Mongolia, this pathogen might losses to alfalfa cultivation. Hence, future research ought to discover points of efficient administration of this illness.

Four new species of Talaromyces part Talaromyces found in China

Four new Talaromyces species with none shut kinfolk are reported right here, specifically, T. aureolinus (ex-type AS3.15865 T), T. bannicus (ex-type AS3.15862 T), T. penicillioides (ex-type AS3.15822 T), and T. sparsus (ex-type AS3.16003 T). Morphologically, T. aureolinus is exclusive in producing orange-yellow mycelium and gymnothecia, singly borne asci, and ellipsoidal, spiny ascospores.
Three Novel Entomopathogenic Fungi From China and Thailand
 Talaromyces bannicus is characterised by the sluggish development price, polymorphic conidiophores, inconsistent stipe lengths, and pyriform to ellipsoidal, echinulate conidia. Talaromyces penicillioides is distinguished by good development and sporulation on malt extract agar (MEA) and yeast extract sucrose agar (YES) media, resembling the colony appearances of sure Penicillium species, and appressed biverticillate and sometimes monoverticillate penicilli bearing globose to ellipsoidal, echinulate conidia.

FSCN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FSCN1 Antibody

DF7988 200ul
EUR 304
Description: FSCN1 Antibody detects endogenous levels of total FSCN1.

FSCN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

FSCN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

Fscn1 antibody

70R-8641 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fscn1 antibody

FSCN1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FSCN1 Antibody

ABD7988 100 ug
EUR 438

FSCN1 Monoclonal Antibody

EUR 300

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (Fscn1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx032965-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx032965-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FSCN1 Conjugated Antibody

C35636 100ul
EUR 397

Fascin (FSCN1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx432714-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fascin (FSCN1) Antibody

abx233018-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-FSCN1 antibody

STJ27695 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ115318 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ23712 100 µl
EUR 413
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ71472 100 µg
EUR 359

Fscn1/ Rat Fscn1 ELISA Kit

ELI-05701r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FSCN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FSCN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FSCN1 Polyclonal Conjugated Antibody

C30401 100ul
EUR 397

Fascin (FSCN1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Fascin/FSCN1 Antibody

PA1575 100ug/vial
EUR 294

Anti-Fascin/FSCN1 Antibody

PB9592 100ug/vial
EUR 294

FSCN1 Rabbit pAb

A13355-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb

A13355-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb

A13355-20ul 20 ul
EUR 183

FSCN1 Rabbit pAb

A13355-50ul 50 ul
EUR 223

Fscn1 Blocking Peptide

33R-9865 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fscn1 antibody, catalog no. 70R-8641

FSCN1 Blocking Peptide

DF7988-BP 1mg
EUR 195

FSCN1 cloning plasmid

CSB-CL619084HU-10ug 10ug
EUR 524
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atgaccgccaacggcacagccgaggcggtgcagatccagttcggcctcatcaactgcggcaacaagtacctgacggccgaggcgttcgggttcaaggtgaacgcgtccgccagcagcctgaagaagaagcagatctggacgctggagcagccccctgacgaggcgggcagcgcgg
  • Show more
Description: A cloning plasmid for the FSCN1 gene.

FSCN1 Rabbit pAb

A5867-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb

A5867-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb

A5867-20ul 20 ul Ask for price

FSCN1 Rabbit pAb

A5867-50ul 50 ul Ask for price

[KO Validated] FSCN1 Polyclonal Antibody

30401-100ul 100ul
EUR 252

[KO Validated] FSCN1 Polyclonal Antibody

30401-50ul 50ul
EUR 187

Polyclonal FSCN1 Antibody (internal region)

APR16037G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FSCN1 (internal region). This antibody is tested and proven to work in the following applications:

Fascin-1(FSCN1/416) Antibody

BNUB0416-100 100uL
EUR 209
Description: Primary antibody against Fascin-1(FSCN1/416), Concentration: 0.2mg/mL

Fascin-1(FSCN1/416) Antibody

BNUB0416-500 500uL
EUR 458
Description: Primary antibody against Fascin-1(FSCN1/416), Concentration: 0.2mg/mL

Fascin-1(FSCN1/417) Antibody

BNUB0417-100 100uL
EUR 209
Description: Primary antibody against Fascin-1(FSCN1/417), Concentration: 0.2mg/mL

Fascin-1(FSCN1/417) Antibody

BNUB0417-500 500uL
EUR 458
Description: Primary antibody against Fascin-1(FSCN1/417), Concentration: 0.2mg/mL

Fascin-1(FSCN1/418) Antibody

BNUB0418-100 100uL
EUR 209
Description: Primary antibody against Fascin-1(FSCN1/418), Concentration: 0.2mg/mL

Fascin-1(FSCN1/418) Antibody

BNUB0418-500 500uL
EUR 458
Description: Primary antibody against Fascin-1(FSCN1/418), Concentration: 0.2mg/mL

Fascin-1(FSCN1/416) Antibody

BNUM0416-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/416), 1mg/mL

Fascin-1(FSCN1/417) Antibody

BNUM0417-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/417), 1mg/mL

Fascin-1(FSCN1/418) Antibody

BNUM0418-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/418), 1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC040416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC040416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC040417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC040417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC040418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC040418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC610416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC610416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC610417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC610417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC610418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC610418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC470416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC470416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC470417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC470417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC470418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC470418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC550416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC550416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC550417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC550417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC550418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC550418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC050416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC050416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC050417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC050417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC050418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC050418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC400416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC400416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC400417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC400417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC400418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF640R conjugate, Concentration: 0.1mg/mL
 Talaromyces sparsus has extensive, submerged colony margins with sparse aerial mycelium, and conidial areas overlaid with yellow-green, sterile hyphae on MEA medium. These 4 new species are effectively supported by particular person phylogenetic timber based mostly on β-tubulin (BENA), calmodulin (CALM), DNA-dependent RNA polymerase II second largest subunit (RPB2), and inside transcribed spacer area (ITS) gene sequences and the tree of the concatenated BENA-CALM-RPB2 sequence.

miR-495 reduces neuronal cell apoptosis and relieves acute spinal cord injury through inhibiting PRDM5

This research goals to research the position of miR-495 in neuronal cell apoptosis after acute spinal cord injury (ASCI). The ASCI rat mannequin was established and the Basso, Beattie, and Bresnahan (BBB) rating was assessed. miR-495, PR area containing 5 (PRDM5), and Bcl-2 expressions have been measured by qRT-PCR or western blotting. Neuronal cell line PC-12 was subjected to hypoxia situation to simulate the in vitro ASCI mannequin. PC-12 cell apoptosis was measured by movement cytometry, and the interplay between miR-495 and PRDM5 was confirmed by twin luciferase reporter assay.

Results confirmed that BBB rating was considerably decreased in ASCI rats in contrast with sham rats. miR-495 expression was down-regulated in spinal cord tissue of ASCI rats and hypoxia-induced PC-12 cells, and PRDM5 protein stage was up-regulated in spinal cord tissue of ASCI rats and hypoxia-induced PC-12 cells. miR-495 overexpression may cut back apoptosis of PC-12 cells, and up-regulated anti-apoptosis protein Bcl-2 protein stage.

Moreover, PRDM5 was a goal of miR-495, and mRNA and protein ranges of PRDM5 have been negatively regulated by miR-495. miR-495 overexpression may cut back the hypoxia-induced PC-12 cell apoptosis, whereas PRDM5 overexpression abolished this inhibiting impact. The agomir-495 was injected into ASCI rats, and Bcl-2 protein stage and BBB rating have been elevated, however the PRDM5 overexpression reversed these outcomes. Overall, we concluded that miR-495 may inhibit neuronal cell apoptosis and relieve acute spinal cord injury through inhibiting PRDM5.

Second-Order Orbital Optimization with Large Active Spaces Using Adaptive Sampling Configuration Interaction (ASCI) and Its Application to Molecular Geometry Optimization

Recently, chosen configuration interplay (SCI) strategies that allow calculations with a number of tens of lively orbitals have been developed. With the SCI subspace embedded within the imply area, molecular orbitals with an accuracy akin to that of the whole lively area self-consistent area methodology will be obtained. Here, we implement the analytical gradient concept for the single-state adaptive sampling CI (ASCI) SCF methodology to allow molecular geometry optimization.
The ensuing analytical gradient is inherently approximate because of the dependence on the sampled determinants, however its accuracy was adequate for performing geometry optimizations with giant lively areas. To acquire the tight convergence wanted for correct analytical gradients, we mix the augmented Hessian (AH) and Werner-Meyer-Knowles (WMK) second-order orbital optimization strategies with the ASCI-SCF methodology. We take a look at these algorithms for orbital and geometry optimizations, display functions of the geometry optimizations of polyacenes and periacenes, and talk about the geometric dependence of the traits of singlet ASCI wave features.

First report of Erysiphe corylacearum, agent of powdery mildew, on hazelnut ( Corylus avellana) in Romania

Romania has an space devoted to hazelnut (Corylus avellana L.), protecting 890 hectares as of 2019. During October 2020, powdery mildew signs have been noticed on the higher facet of leaves of hazelnut ‘Tonda di Giffoni’ in two business orchards in Dudeștii Vechi, Romania (Fig. 1). The illness was current on 70% of the bushes in planting, with no less than 5 leaves per tree having powdery mildew. Micromorphological examination revealed amphigenous, hyaline, branched, septate mycelial patches of two.
Three to three.6 μm in diameter. Conidiophores measured 24-60 × 5-6 (common: 45 × 6) μm and consisted of erect, cylindrical to flexuous foot cells, adopted by 1-2 shorter cells. Ellipsoid, ovoid to doliform conidia have been produced singly and they measured 19-35 × 16-24 (common: 28 × 19) μm. Chasmothecia have been spherical, 75 to 107 (common: 88) μm in diameter. Nine to 13 straight, generally flexuous, appendages measured 54 to 92 (common: 66) μm in size and that they had 5 occasions dichotomous branched apices with curved suggestions (Fig. 2). Each chasmothecium contained three to 5 ellipsoid, ovoid to subglobose asci measuring 41-58 × 29-55 μm (common 52 × 43) μm.
miR-495 reduces neuronal cell apoptosis and relieves acute spinal cord injury through inhibiting PRDM5
The asci contained 4 to eight ascospores measuring 13-24 × 11-15 (common 18 × 14) μm. Morphological identification was confirmed by sequencing the ITS-region of rDNA utilizing two isolates from leaves, saved as frozen mycelium at -20°C. PCR was carried out with Erysiphales-specific primer pair PMITS1/PMITS2 (Cunnington et al. 2003). The obtained sequences have been deposited in GenBank (Accession n° MW423075, MW423076).
Blast evaluation of each sequences had 100% identification to ITS rDNA sequences of Erysiphe corylacearum from Azerbaijan (Abasova et al. 2018; Accession n° LC270863), Turkey (Sezer et al. 2017; KY082910), Switzerland (Beenken et al. 2020; MN82272), Iran (Arzanlou et al. 2018; MH047243), Italy (Mezzalama et al. 2020; MW045425) and 99% identification from Georgia (Meparishvili et al. 2019; MK157199).
The sequences had a decrease % identification (83%) to Phyllactinia guttata (Accession n° AB080558) (Fig. 3). Pathogenicity was verified on one-year-old vegetation of C. avellana ‘Tonda di Giffoni’, which have been artificially inoculated with a conidial suspension from contaminated leaves (n = 25). Inoculated vegetation have been incubated at 20 to 28°C with 70 to 80% relative humidity.
White mycelium appeared on the higher floor of the leaves at eight to 10 days after inoculation. No signs have been discovered on management vegetation sprayed with sterile water. The fungus current on inoculated leaves was morphologically an identical to the unique isolates from diseased bushes from the sector. E. corylacearum is native to East Asia and was beforehand reported in Japan on wild species of Corylus (Takamatsu et al. 2015; Accession n° LC009928).
The pathogen more than likely unfold into Europe from east to west of Europe (Heluta et al. 2019), through the Caucasus, ranging from Turkey, Azerbaijan, Georgia, and Iran. P. guttata was thought of the one causal agent of powdery mildew on hazelnut in most international locations, together with Romania (Brown 1995). Compared to P. guttata, which typically develops a mycelium on the underside of leaves, E. corylacearum grows with a white mycelium on the higher facet of the leaves.

TNN Conjugated Antibody

C37267 100ul
EUR 397


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNN Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNN Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNN Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Tenascin-N (TNN) Antibody

abx027503-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

abx027503-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


ELA-E6753h 96 Tests
EUR 824


EF006402 96 Tests
EUR 689

Mouse TNN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TNN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal TNN antibody - N-terminal region

AMM08262G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNN - N-terminal region. This antibody is tested and proven to work in the following applications:

Tnn ORF Vector (Rat) (pORF)

ORF078047 1.0 ug DNA
EUR 2080

TNN ORF Vector (Human) (pORF)

ORF034128 1.0 ug DNA
EUR 405

Tnn ORF Vector (Mouse) (pORF)

ORF060119 1.0 ug DNA
EUR 1572

TNN ELISA Kit (Mouse) (OKEH05060)

OKEH05060 96 Wells
EUR 779
Description: Description of target: Isoform 2 inhibits neurite outgrowth and cell migration in hippocampal explants while isoform 1 does not have this affect.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.8 pg/mL

Human Tenascin-N(TNN) ELISA kit

CSB-EL024008HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenascin-N (TNN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tenascin-N(TNN) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenascin-N(TNN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tenascin-N (TNN) ELISA Kit

abx251701-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human TNN(Tenascin-N) ELISA Kit

EH2345 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9UQP3
  • Alias: TNN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Tnn/ Tenascin-N ELISA Kit

E1507Mo 1 Kit
EUR 632

Human TNN/ Tenascin-N ELISA Kit

E2557Hu 1 Kit
EUR 605

Human Tenascin- N, TNN ELISA KIT

ELI-07573h 96 Tests
EUR 824

Mouse Tenascin- N, Tnn ELISA KIT

ELI-07574m 96 Tests
EUR 865

Mouse Tenascin-N (TNN) ELISA Kit

abx520606-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Tnn sgRNA CRISPR Lentivector set (Rat)

K6576501 3 x 1.0 ug
EUR 339

Tnn sgRNA CRISPR Lentivector set (Mouse)

K3893901 3 x 1.0 ug
EUR 339

TNN sgRNA CRISPR Lentivector set (Human)

K2419101 3 x 1.0 ug
EUR 339

Human Tenascin N(TNN)ELISA Kit

QY-E03057 96T
EUR 361

Tnn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6576502 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6576503 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6576504 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3893902 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3893903 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3893904 1.0 ug DNA
EUR 154

TNN sgRNA CRISPR Lentivector (Human) (Target 1)

K2419102 1.0 ug DNA
EUR 154

TNN sgRNA CRISPR Lentivector (Human) (Target 2)

K2419103 1.0 ug DNA
EUR 154

TNN sgRNA CRISPR Lentivector (Human) (Target 3)

K2419104 1.0 ug DNA
EUR 154

ELISA kit for Mouse Tenascin-N (TNN)

KTE70103-48T 48T
EUR 332
  • TNN (Tenascin N) is a Protein Coding gene. Diseases associated with TNN include Dysplastic Nevus Syndrome. Among its related pathways are ECM proteoglycans and ECM-receptor interaction. GO annotations related to this gene include identical protein bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenascin-N (TNN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenascin-N (TNN)

KTE70103-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TNN (Tenascin N) is a Protein Coding gene. Diseases associated with TNN include Dysplastic Nevus Syndrome. Among its related pathways are ECM proteoglycans and ECM-receptor interaction. GO annotations related to this gene include identical protein bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenascin-N (TNN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenascin-N (TNN)

KTE70103-96T 96T
EUR 539
  • TNN (Tenascin N) is a Protein Coding gene. Diseases associated with TNN include Dysplastic Nevus Syndrome. Among its related pathways are ECM proteoglycans and ECM-receptor interaction. GO annotations related to this gene include identical protein bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenascin-N (TNN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TNN Protein Vector (Human) (pPB-C-His)

PV136510 500 ng
EUR 811

TNN Protein Vector (Human) (pPB-N-His)

PV136511 500 ng
EUR 811

TNN Protein Vector (Human) (pPM-C-HA)

PV136512 500 ng
EUR 811

TNN Protein Vector (Human) (pPM-C-His)

PV136513 500 ng
EUR 811

TNN Protein Vector (Rat) (pPB-C-His)

PV312186 500 ng
EUR 2632

TNN Protein Vector (Rat) (pPB-N-His)

PV312187 500 ng
EUR 2632

TNN Protein Vector (Rat) (pPM-C-HA)

PV312188 500 ng
EUR 2632

TNN Protein Vector (Rat) (pPM-C-His)

PV312189 500 ng
EUR 2632

TNN Protein Vector (Mouse) (pPB-C-His)

PV240474 500 ng
EUR 2629

TNN Protein Vector (Mouse) (pPB-N-His)

PV240475 500 ng
EUR 2629

TNN Protein Vector (Mouse) (pPM-C-HA)

PV240476 500 ng
EUR 2629

TNN Protein Vector (Mouse) (pPM-C-His)

PV240477 500 ng
EUR 2629

Tnn 3'UTR Luciferase Stable Cell Line

TU120915 1.0 ml Ask for price

Tnn 3'UTR GFP Stable Cell Line

TU170915 1.0 ml Ask for price

Tnn 3'UTR Luciferase Stable Cell Line

TU222267 1.0 ml Ask for price

TNN 3'UTR GFP Stable Cell Line

TU076053 1.0 ml
EUR 1394

TNN 3'UTR Luciferase Stable Cell Line

TU026053 1.0 ml
EUR 1394

Tnn 3'UTR GFP Stable Cell Line

TU272267 1.0 ml Ask for price

TNN ELISA Kit (Human) : 96 Wells (OKEH01796)

OKEH01796 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Tnn ELISA Kit| Mouse Tenascin-N ELISA Kit

EF016364 96 Tests
EUR 689

TNN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650575 1.0 ug DNA
EUR 2457

TNN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650579 1.0 ug DNA
EUR 2457

TNN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650580 1.0 ug DNA
EUR 2457

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6576505 3 x 1.0 ug
EUR 376

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3893905 3 x 1.0 ug
EUR 376

TNN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2419105 3 x 1.0 ug
EUR 376

TNN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV650576 1.0 ug DNA
EUR 2457

TNN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV650577 1.0 ug DNA
EUR 2515

TNN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV650578 1.0 ug DNA
EUR 2515

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6576506 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6576507 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6576508 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3893907 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3893908 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3893906 1.0 ug DNA
EUR 167

TNN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2419106 1.0 ug DNA
EUR 167

TNN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2419107 1.0 ug DNA
EUR 167

TNN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2419108 1.0 ug DNA
EUR 167

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug