First Report of Erysiphe palczewskii Powdery Mildew of Siberian Pea Tree (Caragana arborescens) in Wisconsin and Quebec.

Shoots affected by powdery mildew had been collected from Siberian pea bushes in July 2009 on the University of Wisconsin-Madison campus and on the campus of Université Laval, Quebec City, Quebec. This unique shrub or small tree is occasionally planted in Wisconsin and three shrubs in a bunch that had been affected are the one examples identified on the UW-Madison campus.
In Quebec City, Siberian pea tree is extra generally used as a decorative, usually in hedges (as is the case of the affected vegetation on the Université Laval campus). In each areas, <10% of foliage was visibly affected, however incidence was better on shoots nearer to the bottom than on increased shoots. White-to-grayish mycelium was current on leaves and younger stems and generally utterly lined each higher and decrease leaf surfaces. Dark brown-to-black chasmothecia had been quite a few on leaf blades, petioles, and younger stems, however had been most plentiful on decrease surfaces of leaves.
Morphology of chasmothecia, together with appendages with distinctive terminal dichotomous branching, (1) was in line with descriptions and illustrations of the fungus Erysiphe palczewskii Jacz. (synonym Microsphaera palczewskii) (1-4) considered native to Asia, however often known as an invader of Europe the place it happens on the identical host. For a pattern from Université Laval, imply diameter of chasmothecia was 113 μm, imply appendage size was 185 μm, and barrel-shaped conidia that lacked fibrosin our bodies averaged 30 × 14 μm. Asci contained oval, yellow ascospores with imply dimensions of 20 × 12 μm.
DNA was extracted from chasmothecia, and nuclear rDNA sequences (633 nucleotides) of the Wisconsin (GenBank Accession No. GQ497277) and Quebec (GenBank Accession No. GQ497276) specimens differed by just one nucleotide. The sequences that had been obtained most intently matched GenBank sequences for Oidium spp. (98%) and Erysiphe spp. (97%). Further observations indicated that the identical pathogen affected Siberian pea bushes planted as ornamentals at a number of areas separated by ≥15 km in the metropolitan Quebec space.
This report extends the japanese identified restrict of E. palczewskii in the United States, beforehand identified from collections in Alaska (2), Washington (4), Idaho (4), North Dakota (3), and Minnesota (3). To our information, that is the primary report of this illness in Canada, and it signifies that the distribution of E. palczewskii is transcontinental.
Specimens from Madison, WI and Quebec, QC have been deposited in the U.S. National Fungus Collections (BPI 879152) and the Rene Pomerleau Herbarium of the Canadian Forest Service Laurentian Forestry Centre (QFB-22601). References: (1) U. Braun. Beih. Nova Hedwigia 89:1, 1987. (2) D. A. Glawe and G. A. Laursen. Online publication. doi:10:1094/PHP-2005-1017-01-BR. Plant Health Progress, 2005. (3) D. A. Glawe et al. Online publication. doi:10.1094/PHP-2006-0117-01-BR. Plant Health Progress, 2006. (4) C. Nischwitz and G. Newcombe. Plant Dis. 87:451, 2003.

First Report of Powdery Mildew Caused by Golovinomyces biocellatus on Peppermint in California.

In August of 2009, powdery mildew was noticed on peppermint (Mentha piperita L.) in a number of industrial fields in the Fall River Valley of japanese Shasta County, California. Plant progress was apparently diminished by the illness, however its affect on yield was unknown. White fungal progress was restricted to the adaxial surfaces, the place colonies had been skinny and effused. Heavily contaminated leaves developed a reddish tint as progress prematurely ceased. Doliform conidia ([26.6-] 29.2 [-31.7] × [13.2-] 15.6 [-16.8] μm) had been produced in chains of roughly six conidia.
Foot cells had been cylindrical ([41.3-] 55.2 [-75.0] × [11.2-] 12.0 [-12.8] μm). Immature chasmothecia had been yellowish brown and roughly 100.Zero μm in diameter with flexuous, mycelium-like appendages as much as 200 μm lengthy. All these options had been in line with these of Golovinomyces biocellatus. Asci weren’t noticed. To affirm the identification of the fungus, nuclear rDNA inside transcribed spacer (ITS) areas had been amplified by PCR with common primers ITS4 and ITS5.
The sequence (537 bp) was a precise match for a number of submissions of G. biocellatus in GenBank (e.g., Accession No. EU035602, a sequence of the fungus from mint in Australia [1]). Pathogenicity was confirmed by brushing spores from naturally contaminated leaves onto three rooted cuttings of M. piperita ‘Black Mitchum’. After the vegetation had been lined with a plastic bag for 36 h to keep up excessive humidity, they had been stored on a greenhouse bench at 23 to 28°C.
Three noninoculated vegetation, which served as controls, had been positioned in one other greenhouse in related situations. The experiment was repeated as soon as. All inoculated vegetation developed indicators of powdery mildew inside 7 days of inoculation whereas noninoculated vegetation remained illness free. The fungus on inoculated leaves was morphologically indistinguishable from the one used to inoculate the vegetation. To our information, that is the primary report of G. biocellatus on peppermint in California. References: (1) J. R. Liberato and J. H. Cunnington. Australas, Plant Dis. Notes 2:38, 2007.

Root and Crown Rot of Anthurium Caused by Calonectria ilicicola in Iran.

In the autumn of 2008, a extreme illness of Anthurium andraeanum with wilting and root and crown rot signs was noticed in a greenhouse in the Varamin space of Tehran. A species of Calonectria was remoted constantly from symptomatic tissues on 2% potato dextrose agar (PDA). The fungus produced perithecia and a Cylindrocladium anamorph when incubated on carnation leaf agar beneath near-ultraviolet mild at 25°C. Perithechia had been reddish brown, subglobose to ovoid, and 300 to 400 μm in diameter. Asci had been clavate, hyaline, 90 to 140 × 12 to 19 μm, and tapering to a protracted skinny stalk.
 First Report of Erysiphe palczewskii Powdery Mildew of Siberian Pea Tree (Caragana arborescens) in Wisconsin and Quebec.
Ascospores had been fusoid, straight to barely curved, 1- (-3) septate, and (30-) 37 to 50 (-65) × (4-) 5 to six.5 (-7) μm (imply = 45 × 6 μm; n = 30). Penicillate conidiophores gave rise to stipe extensions that terminated in sphaeropedunculate vesicles (6-) 7 to 10 (-12) μm in diameter. Conidia had been hyaline, cylindrical, rounded at each ends, straight, (45-) 70 to 82 (-90) × (4-) 5 to six.5(-7) μm (imply = 62 × 6 μm; n = 30), and (1-) 3-septate. On the premise of morphology, the fungus was recognized as Calonectria ilicicola Boedijin & Reitsma.
Koch’s postulates had been fulfilled by spray inoculating 1-month-old seedlings with a conidial and mycelial suspension (105 particles per ml) of the fungus obtained from 14-day-old single-spore colonies grown on PDA at 25°C. Following inoculation, all vegetation had been maintained in plastic baggage in a glasshouse at 25 ± 1°C. After 15 to 25 days, signs resembling these seen in the diseased glasshouse had been detected on inoculated vegetation. C. ilicicola was reisolated from the artificially contaminated tissues.
No signs had been detected on the management vegetation. Nucleotide sequences of the interior transcribed spacer (ITS) areas of the nrDNA operon and the partial histone H3 gene had been decided for derived pressure CPC 16334 as described beforehand (1,3). The ITS sequence (GenBank Accession No. GU057378) matched 100% (644/644 bp) with the sequence of C. ilicicola pressure CBS 463.76 (GenBank AF493963) and the histone H3 sequence (GenBank GU057379) matched 99% (456/458 bp; as a result of two versus three AC repeats in the sequence) with that of C.

Human Neurofascin (NFASC) ELISA Kit

RDR-NFASC-Hu-48Tests 48 Tests
EUR 589

Human Neurofascin (NFASC) ELISA Kit

RDR-NFASC-Hu-96Tests 96 Tests
EUR 820

Neurofascin (NFASC) Antibody

20-abx002202
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurofascin (NFASC) Antibody

20-abx101003
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurofascin (NFASC) Antibody

20-abx173762
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurofascin (NFASC) Antibody

20-abx214122
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurofascin (NFASC) Antibody

abx431852-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Neurofascin (NFASC) Antibody

20-abx241687
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Neurofascin (NFASC)

1-CSB-EP015743HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 15.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neurofascin(NFASC),partial expressed in E.coli

Recombinant Neurofascin (NFASC)

4-RPL939Hu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O94856
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Neurofascin expressed in: E.coli

Human Neurofascin (NFASC) Protein

20-abx068240
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Neurofascin (NFASC) Polyclonal Antibody (Human)

4-PAL939Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC)

Neurofascin (NFASC) Polyclonal Antibody (Human), Biotinylated

4-PAL939Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with Biotin.

Neurofascin (NFASC) Polyclonal Antibody (Human), Cy3

4-PAL939Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with Cy3.

Neurofascin (NFASC) Polyclonal Antibody (Human), FITC

4-PAL939Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with FITC.

Neurofascin (NFASC) Polyclonal Antibody (Human), HRP

4-PAL939Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with HRP.

Neurofascin (NFASC) Polyclonal Antibody (Human), PE

4-PAL939Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with PE.

Neurofascin (NFASC) Polyclonal Antibody (Human), APC

4-PAL939Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with APC.

Human Neurofascin (NFASC) CLIA Kit

20-abx495996
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurofascin, NFASC ELISA KIT

ELI-20708h 96 Tests
EUR 824

Chicken Neurofascin, NFASC ELISA KIT

ELI-15003c 96 Tests
EUR 928

Mouse Neurofascin, Nfasc ELISA KIT

ELI-45737m 96 Tests
EUR 865

Human Neurofascin (NFASC) ELISA Kit

20-abx152492
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Neurofascin (NFASC) ELISA Kit

abx390014-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neurofascin (NFASC) ELISA Kit

abx391685-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neurofascin(NFASC) ELISA kit

CSB-EL015743HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurofascin (NFASC) in samples from serum, plasma, cerebrospinalfluid (CSF), tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neurofascin(NFASC) ELISA kit

1-CSB-EL015743HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurofascin(NFASC) in samples from serum, plasma, cerebrospinalfluid(CSF), tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Neurofascin(NFASC)ELISA Kit

QY-E01656 96T
EUR 394

Human Neurofascin (NFASC) ELISA Kit

SEL939Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofascin (NFASC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofascin (NFASC) in Tissue homogenates and other biological fluids.

Human Neurofascin (NFASC) ELISA Kit

SEL939Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofascin (NFASC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofascin (NFASC) in Tissue homogenates and other biological fluids.

Human Neurofascin (NFASC) ELISA Kit

SEL939Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofascin (NFASC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofascin (NFASC) in Tissue homogenates and other biological fluids.

Human Neurofascin (NFASC) ELISA Kit

SEL939Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofascin (NFASC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofascin (NFASC) in Tissue homogenates and other biological fluids.

Human Neurofascin (NFASC) ELISA Kit

4-SEL939Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurofascin elisa. Alternative names of the recognized antigen: NF
  • NRCAML
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurofascin (NFASC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Neurofascin (NFASC) Polyclonal Antibody (Human), APC-Cy7

4-PAL939Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFASC (Asn760~Ala1007)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurofascin (NFASC). This antibody is labeled with APC-Cy7.

ELISA kit for Human NFASC (Neurofascin)

ELK6104 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurofascin (NFASC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurofascin (N
  • Show more
Description: A sandwich ELISA kit for detection of Neurofascin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rabbit Anti- Rat neurofascin (Nfasc)-phospor IgG (aff pure)

AB-23249-A 100ug
EUR 482

Nfasc ELISA Kit| Rat Neurofascin ELISA Kit

EF019045 96 Tests
EUR 689

Nfasc ELISA Kit| Mouse Neurofascin ELISA Kit

EF015653 96 Tests
EUR 689

NFASC ELISA Kit| chicken Neurofascin ELISA Kit

EF012420 96 Tests
EUR 689

Rat neurofascin (Nfasc)-control Control/blocking peptide

AB-23249-CP 100ug
EUR 164

Rat neurofascin (Nfasc)-phosphor Control/blocking peptide

AB-23249-P 100ug
EUR 164

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-100ug

QP6416-ec-100ug 100ug
EUR 408

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-10ug

QP6416-ec-10ug 10ug
EUR 200

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-1mg

QP6416-ec-1mg 1mg
EUR 1632

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-200ug

QP6416-ec-200ug 200ug
EUR 634

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-500ug

QP6416-ec-500ug 500ug
EUR 1060

Recombinant Human NFASC/ Neurofascin Protein, His, E.coli-50ug

QP6416-ec-50ug 50ug
EUR 263

Anti-NFASC antibody

STJ24750 100 µl
EUR 277
Description: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined.

Anti-Neurofascin (aa877-890) antibody

STJ72603 100 µg
EUR 359

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Neurofascin

PR15066 50 ug
EUR 468

NFASC Antibody

ABD7160 100 ug
EUR 438

NFASC antibody

38553-100ul 100ul
EUR 252

NFASC Antibody

31250-100ul 100ul
EUR 252

NFASC Antibody

31250-50ul 50ul
EUR 187

NFASC Antibody

DF7160 200ul
EUR 304
Description: NFASC Antibody detects endogenous levels of total NFASC.

NFASC Antibody

1-CSB-PA787178
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NFASC. Recognizes NFASC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NFASC Antibody

1-CSB-PA073153
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NFASC. Recognizes NFASC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

NFASC Conjugated Antibody

C38553 100ul
EUR 397

NFASC Conjugated Antibody

C31250 100ul
EUR 397

Nfasc/ Rat Nfasc ELISA Kit

ELI-22181r 96 Tests
EUR 886

NFASC siRNA

20-abx903541
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFASC siRNA

20-abx925794
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFASC siRNA

20-abx925795
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

NFASC Rabbit pAb

A3053-100ul 100 ul
EUR 308

NFASC Rabbit pAb

A3053-200ul 200 ul
EUR 459

NFASC Rabbit pAb

A3053-20ul 20 ul
EUR 183

NFASC Rabbit pAb

A3053-50ul 50 ul
EUR 223

NFASC Blocking Peptide

DF7160-BP 1mg
EUR 195

Polyclonal Neurofascin (aa877-890) Antibody (internal region)

AMM06631G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Neurofascin (aa877-890) (internal region). This antibody is tested and proven to work in the following applications:

Rat NFASC shRNA Plasmid

20-abx987343
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NFASC shRNA Plasmid

20-abx983017
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NFASC ELISA KIT|Human

EF005338 96 Tests
EUR 689

Human NFASC shRNA Plasmid

20-abx958008
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NFASC ORF Vector (Human) (pORF)

ORF026068 1.0 ug DNA
EUR 405

Nfasc ORF Vector (Rat) (pORF)

ORF071257 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Rat) (pORF)

ORF071258 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Rat) (pORF)

ORF071259 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Rat) (pORF)

ORF071260 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Mouse) (pORF)

ORF051272 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Mouse) (pORF)

ORF051273 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Mouse) (pORF)

ORF051274 1.0 ug DNA
EUR 506

Nfasc ORF Vector (Mouse) (pORF)

ORF051275 1.0 ug DNA
EUR 506

NFASC ELISA Kit (Human) (OKCD01074)

OKCD01074 96 Wells
EUR 909
Description: Description of target: Cell adhesion, ankyrin-binding protein which may be involved in neurite extension, axonal guidance, synaptogenesis, myelination and neuron-glial cell interactions.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

NFASC sgRNA CRISPR Lentivector set (Human)

K1420901 3 x 1.0 ug
EUR 339

Nfasc sgRNA CRISPR Lentivector set (Mouse)

K4184901 3 x 1.0 ug
EUR 339

Nfasc sgRNA CRISPR Lentivector set (Rat)

K7550101 3 x 1.0 ug
EUR 339

NFASC sgRNA CRISPR Lentivector (Human) (Target 1)

K1420902 1.0 ug DNA
EUR 154

NFASC sgRNA CRISPR Lentivector (Human) (Target 2)

K1420903 1.0 ug DNA
EUR 154

NFASC sgRNA CRISPR Lentivector (Human) (Target 3)

K1420904 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4184902 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4184903 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4184904 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Rat) (Target 1)

K7550102 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Rat) (Target 2)

K7550103 1.0 ug DNA
EUR 154

Nfasc sgRNA CRISPR Lentivector (Rat) (Target 3)

K7550104 1.0 ug DNA
EUR 154

NFASC Protein Vector (Human) (pPB-C-His)

PV104270 500 ng
EUR 552

NFASC Protein Vector (Human) (pPB-N-His)

PV104271 500 ng
EUR 552

NFASC Protein Vector (Human) (pPM-C-HA)

PV104272 500 ng
EUR 552

NFASC Protein Vector (Human) (pPM-C-His)

PV104273 500 ng
EUR 552

NFASC Protein Vector (Rat) (pPB-C-His)

PV285026 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-N-His)

PV285027 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-HA)

PV285028 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-His)

PV285029 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-C-His)

PV285030 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-N-His)

PV285031 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-HA)

PV285032 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-His)

PV285033 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-C-His)

PV285034 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-N-His)

PV285035 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-HA)

PV285036 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-His)

PV285037 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-C-His)

PV285038 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPB-N-His)

PV285039 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-HA)

PV285040 500 ng
EUR 1191

NFASC Protein Vector (Rat) (pPM-C-His)

PV285041 500 ng
EUR 1191

NFASC Protein Vector (Mouse) (pPB-C-His)

PV205086 500 ng
EUR 1065

NFASC Protein Vector (Mouse) (pPB-N-His)

PV205087 500 ng
EUR 1065

NFASC Protein Vector (Mouse) (pPM-C-HA)

PV205088 500 ng
EUR 1065
ilicicola pressure CBS 112217 (GenBank AY725686). To our information, that is the primary report of Calonectria and Cylindrocladium genera and the illness brought on by C. ilicicola from Iran. References: (1) R. Cheewangkoon et al. Persoonia 23:55, 2009. (2) P. W. Crous and M. J. Wingfield. Mycotaxon 51:341, 1994. (3) P. W. Crous et al. Stud. Mycol. 50:415, 2004.

Three Novel Entomopathogenic Fungi From China and Thailand

Entomopathogenic fungi are ubiquitous in tropical rainforests and function a excessive stage of range. This group of fungi not solely has necessary ecological worth but in addition medicinal worth. Nevertheless, they’re typically ignored, and many unknown species have but to be found and described. The current examine goals to contribute to the taxonomical and phylogenetic understanding of the genus Paraisaria by describing three new species collected from Guizhou and Yunnan Provinces in China and Krabi Province in Thailand.
The three novel species named Paraisaria alba, P. arcta, and P. rosea share comparable morphologies as these within the genus Paraisaria, containing solitary, easy, fleshy stroma, fully immersed perithecia and cylindrical asci with thickened caps and filiform ascospores that usually disarticulate at maturity. Phylogenetic analyses of mixed LSU, SSU, TEF1-α, RPB1, RPB2, and ITS sequence knowledge verify their placement within the genus Paraisaria. In this examine, the three entomopathogenic taxa are comprehensively described with colour images and phylogenetic analyses. A synopsis desk and a key to all handled species of Paraisaria are additionally included.

First report of alfalfa leaf spot brought on by Leptosphaerulina australis in China

A illness was noticed on alfalfa cultivar WL168 characterised by white to brown leaf spots of normal to spherical shapes, in Aluhorqin County, Inner Mongolia, China (120°13’23″ to 120°29’14″ E, 43°27’52″to 43°35’16″ N, 281.71m to360.13 m Altitude) throughout 2019 to 2020. The illness primarily offered in spring one month after re-greening and the incidence was 78.30% on this discipline.
Twenty alfalfa vegetation with extreme signs had been used for pathogen isolation. The contaminated tissue was reduce into 2 × 2 mm items, surface-sterilized (in 75% ethanol and 5% business bleach (NaClO) for 30 s and 2 min, respectively), rinsed 5 occasions with sterilized distilled water, and dried between sterile filter paper (Wang et al. 2019). The diseased tissue from every plant pattern had been cultured on potato dextrose agar (PDA) and incubated at 25 °C with 12 h mild/day for ten days.
A fungus was remoted from the diseased leaves at a 100% frequency. Fungal development on PDA was spherical with a black floor, radial edge, and a unclean white middle. The ascocarps had been moved to a clear microscope slide to launch asci and ascospores. Ascocarps had been spheroidal, subglobose brown, 120 to 160 µm × 160 to 180 µm, which include a number of ascus. The dimension of ascus had been 31.zero to 41.6 μm × 75.zero to 87.5 μm and every asci having eight ascospores.
Ascospores had been ellipsoid to rectangular with a gelatinous sheath, brown, 8.Eight to 15.zero µm × 29.9 to 43.zero µm with 2 to three horizontal septums, and zero to 2 vertical septums. A phylogenetic tree was constructed after DNA extraction, PCR with primers to amplify the ITS (VG9: 5′- TTACGTCCCTGCCCTTTGTA-3′ and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′) and LSU (LR7: 5′-TACTACCACCAAGATCT-3′ and LROR: 5′- GTACCCGCTGA ACTTAAGC -3′) areas. The LSU (SUB8273071) and ITS (SUB8218291) amplicons confirmed 99% similarity with L. australis (EU754166.1) within the GenBank.
To confirm the pathogenicity, fungs plugs had been inverted on three compound leaves of 20 alfalfa WL168 for 2 days. Agar plugs (PDA) had been inverted on one other 20 alfalfa WL168 three compound leaves which had been management. All vegetation had been maintained at 22 °C and 44% relative humidity in a development chamber. Similar illness signs had been noticed on contaminated leaves ten days after inoculation, whereas management vegetation confirmed no signs.
The similar fungus was re-isolated from the lesions, and additional morphological characterization and molecular assays, as described above. L. australis has been reported on numerous vegetation, together with Prunusarmeniaca, Dolichos, Poa, Lolium, and Vitis in Australia (Graham and Luttrell., 1961), and additionally from Korean soil in 2018 (Weilan et al., 2018). Additionally, L. briosiana, which is frequent within the USA, China, and different nations, causes Leptosphaerulina leaf spot (Samacet al., 2015). L. trifolii is newly reported to happen in China (Liu et al., 2019). To one of the best of our information, that is the primary report of L. australis infecting alfalfa in China. Considering the big planting space in Inner Mongolia, this pathogen might losses to alfalfa cultivation. Hence, future research ought to discover points of efficient administration of this illness.

Four new species of Talaromyces part Talaromyces found in China

Four new Talaromyces species with none shut kinfolk are reported right here, specifically, T. aureolinus (ex-type AS3.15865 T), T. bannicus (ex-type AS3.15862 T), T. penicillioides (ex-type AS3.15822 T), and T. sparsus (ex-type AS3.16003 T). Morphologically, T. aureolinus is exclusive in producing orange-yellow mycelium and gymnothecia, singly borne asci, and ellipsoidal, spiny ascospores.
Three Novel Entomopathogenic Fungi From China and Thailand
 Talaromyces bannicus is characterised by the sluggish development price, polymorphic conidiophores, inconsistent stipe lengths, and pyriform to ellipsoidal, echinulate conidia. Talaromyces penicillioides is distinguished by good development and sporulation on malt extract agar (MEA) and yeast extract sucrose agar (YES) media, resembling the colony appearances of sure Penicillium species, and appressed biverticillate and sometimes monoverticillate penicilli bearing globose to ellipsoidal, echinulate conidia.

FSCN1 antibody

70R-17358 50 ul
EUR 435
Description: Rabbit polyclonal FSCN1 antibody

FSCN1 Antibody

DF7988 200ul
EUR 304
Description: FSCN1 Antibody detects endogenous levels of total FSCN1.

FSCN1 Antibody

1-CSB-PA005142
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

FSCN1 Antibody

1-CSB-PA619084LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FSCN1 Antibody

1-CSB-PA009010GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FSCN1 Antibody

1-CSB-PA182867
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

FSCN1 Antibody

1-CSB-PA203862
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

FSCN1 Conjugated Antibody

C35636 100ul
EUR 397

Fascin (FSCN1) Antibody

20-abx126914
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Fascin (Fscn1) Antibody

20-abx112474
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx141208
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx032965-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx032965-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx006708
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx327559
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx214267
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

20-abx338423
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx432714-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fascin (FSCN1) Antibody

20-abx241222
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody

abx233018-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

FSCN1 Monoclonal Antibody

A1062-50
EUR 300

Anti-FSCN1 antibody

STJ71472 100 µg
EUR 359

Anti-FSCN1 antibody

STJ23712 100 µl
EUR 413
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ27695 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Anti-FSCN1 antibody

STJ115318 100 µl
EUR 277
Description: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15.

Fscn1/ Rat Fscn1 ELISA Kit

ELI-05701r 96 Tests
EUR 886

FSCN1 siRNA

20-abx902015
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 siRNA

20-abx917244
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 siRNA

20-abx917245
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FSCN1 Polyclonal Conjugated Antibody

C30401 100ul
EUR 397

Fascin (FSCN1) Antibody (HRP)

20-abx335658
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (FITC)

20-abx335659
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fascin (FSCN1) Antibody (Biotin)

20-abx335660
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FSCN1 Antibody, HRP conjugated

1-CSB-PA619084LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FSCN1 Antibody, FITC conjugated

1-CSB-PA619084LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FSCN1 Antibody, Biotin conjugated

1-CSB-PA619084LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSCN1. Recognizes FSCN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Fascin/FSCN1 Antibody

PB9592 100ug/vial
EUR 294

Anti-Fascin/FSCN1 Antibody

PA1575 100ug/vial
EUR 294

FSCN1 Rabbit pAb

A5867-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb

A5867-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb

A5867-20ul 20 ul Ask for price

FSCN1 Rabbit pAb

A5867-50ul 50 ul Ask for price

FSCN1 Rabbit pAb

A13355-100ul 100 ul
EUR 308

FSCN1 Rabbit pAb

A13355-200ul 200 ul
EUR 459

FSCN1 Rabbit pAb

A13355-20ul 20 ul
EUR 183

FSCN1 Rabbit pAb

A13355-50ul 50 ul
EUR 223

Fscn1 Blocking Peptide

33R-9865 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fscn1 antibody, catalog no. 70R-8641

FSCN1 Blocking Peptide

DF7988-BP 1mg
EUR 195

FSCN1 cloning plasmid

CSB-CL619084HU-10ug 10ug
EUR 524
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atgaccgccaacggcacagccgaggcggtgcagatccagttcggcctcatcaactgcggcaacaagtacctgacggccgaggcgttcgggttcaaggtgaacgcgtccgccagcagcctgaagaagaagcagatctggacgctggagcagccccctgacgaggcgggcagcgcgg
  • Show more
Description: A cloning plasmid for the FSCN1 gene.

Polyclonal FSCN1 Antibody (internal region)

APR16037G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FSCN1 (internal region). This antibody is tested and proven to work in the following applications:

Fascin-1(FSCN1/416) Antibody

BNC610416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC610416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC610417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC610417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC610418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC610418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF660R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC680416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC680416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC680417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC680417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC680418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC680418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF568 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC400416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC400416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC400417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC400417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC400418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC400418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF640R conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC430416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC430416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC430417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC430417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC430418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC430418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF543 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC550416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC550416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC550417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC550417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC550418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC550418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF555 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC040416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC040416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC040417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC040417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC040418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC040418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF405S conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC050416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC050416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC050417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC050417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC050418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC050418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF405M conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC470416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC470416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC470417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC470417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC470418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC470418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF647 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNUM0416-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/416), 1mg/mL

Fascin-1(FSCN1/417) Antibody

BNUM0417-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/417), 1mg/mL

Fascin-1(FSCN1/418) Antibody

BNUM0418-50 50uL
EUR 395
Description: Primary antibody against Fascin-1(FSCN1/418), 1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC700416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC700416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC700417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC700417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC700418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC700418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF770 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC940416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNC940416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC940417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNC940417-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/417), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC940418-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/418), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/418) Antibody

BNC940418-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/418), CF594 conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNCH0416-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/416), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/416) Antibody

BNCH0416-500 500uL
EUR 544
Description: Primary antibody against Fascin-1(FSCN1/416), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Fascin-1(FSCN1/417) Antibody

BNCH0417-100 100uL
EUR 199
Description: Primary antibody against Fascin-1(FSCN1/417), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
 Talaromyces sparsus has extensive, submerged colony margins with sparse aerial mycelium, and conidial areas overlaid with yellow-green, sterile hyphae on MEA medium. These 4 new species are effectively supported by particular person phylogenetic timber based mostly on β-tubulin (BENA), calmodulin (CALM), DNA-dependent RNA polymerase II second largest subunit (RPB2), and inside transcribed spacer area (ITS) gene sequences and the tree of the concatenated BENA-CALM-RPB2 sequence.

miR-495 reduces neuronal cell apoptosis and relieves acute spinal cord injury through inhibiting PRDM5

This research goals to research the position of miR-495 in neuronal cell apoptosis after acute spinal cord injury (ASCI). The ASCI rat mannequin was established and the Basso, Beattie, and Bresnahan (BBB) rating was assessed. miR-495, PR area containing 5 (PRDM5), and Bcl-2 expressions have been measured by qRT-PCR or western blotting. Neuronal cell line PC-12 was subjected to hypoxia situation to simulate the in vitro ASCI mannequin. PC-12 cell apoptosis was measured by movement cytometry, and the interplay between miR-495 and PRDM5 was confirmed by twin luciferase reporter assay.

Results confirmed that BBB rating was considerably decreased in ASCI rats in contrast with sham rats. miR-495 expression was down-regulated in spinal cord tissue of ASCI rats and hypoxia-induced PC-12 cells, and PRDM5 protein stage was up-regulated in spinal cord tissue of ASCI rats and hypoxia-induced PC-12 cells. miR-495 overexpression may cut back apoptosis of PC-12 cells, and up-regulated anti-apoptosis protein Bcl-2 protein stage.

Moreover, PRDM5 was a goal of miR-495, and mRNA and protein ranges of PRDM5 have been negatively regulated by miR-495. miR-495 overexpression may cut back the hypoxia-induced PC-12 cell apoptosis, whereas PRDM5 overexpression abolished this inhibiting impact. The agomir-495 was injected into ASCI rats, and Bcl-2 protein stage and BBB rating have been elevated, however the PRDM5 overexpression reversed these outcomes. Overall, we concluded that miR-495 may inhibit neuronal cell apoptosis and relieve acute spinal cord injury through inhibiting PRDM5.

Second-Order Orbital Optimization with Large Active Spaces Using Adaptive Sampling Configuration Interaction (ASCI) and Its Application to Molecular Geometry Optimization

Recently, chosen configuration interplay (SCI) strategies that allow calculations with a number of tens of lively orbitals have been developed. With the SCI subspace embedded within the imply area, molecular orbitals with an accuracy akin to that of the whole lively area self-consistent area methodology will be obtained. Here, we implement the analytical gradient concept for the single-state adaptive sampling CI (ASCI) SCF methodology to allow molecular geometry optimization.
The ensuing analytical gradient is inherently approximate because of the dependence on the sampled determinants, however its accuracy was adequate for performing geometry optimizations with giant lively areas. To acquire the tight convergence wanted for correct analytical gradients, we mix the augmented Hessian (AH) and Werner-Meyer-Knowles (WMK) second-order orbital optimization strategies with the ASCI-SCF methodology. We take a look at these algorithms for orbital and geometry optimizations, display functions of the geometry optimizations of polyacenes and periacenes, and talk about the geometric dependence of the traits of singlet ASCI wave features.

First report of Erysiphe corylacearum, agent of powdery mildew, on hazelnut ( Corylus avellana) in Romania

Romania has an space devoted to hazelnut (Corylus avellana L.), protecting 890 hectares as of 2019. During October 2020, powdery mildew signs have been noticed on the higher facet of leaves of hazelnut ‘Tonda di Giffoni’ in two business orchards in Dudeștii Vechi, Romania (Fig. 1). The illness was current on 70% of the bushes in planting, with no less than 5 leaves per tree having powdery mildew. Micromorphological examination revealed amphigenous, hyaline, branched, septate mycelial patches of two.
Three to three.6 μm in diameter. Conidiophores measured 24-60 × 5-6 (common: 45 × 6) μm and consisted of erect, cylindrical to flexuous foot cells, adopted by 1-2 shorter cells. Ellipsoid, ovoid to doliform conidia have been produced singly and they measured 19-35 × 16-24 (common: 28 × 19) μm. Chasmothecia have been spherical, 75 to 107 (common: 88) μm in diameter. Nine to 13 straight, generally flexuous, appendages measured 54 to 92 (common: 66) μm in size and that they had 5 occasions dichotomous branched apices with curved suggestions (Fig. 2). Each chasmothecium contained three to 5 ellipsoid, ovoid to subglobose asci measuring 41-58 × 29-55 μm (common 52 × 43) μm.
miR-495 reduces neuronal cell apoptosis and relieves acute spinal cord injury through inhibiting PRDM5
The asci contained 4 to eight ascospores measuring 13-24 × 11-15 (common 18 × 14) μm. Morphological identification was confirmed by sequencing the ITS-region of rDNA utilizing two isolates from leaves, saved as frozen mycelium at -20°C. PCR was carried out with Erysiphales-specific primer pair PMITS1/PMITS2 (Cunnington et al. 2003). The obtained sequences have been deposited in GenBank (Accession n° MW423075, MW423076).
Blast evaluation of each sequences had 100% identification to ITS rDNA sequences of Erysiphe corylacearum from Azerbaijan (Abasova et al. 2018; Accession n° LC270863), Turkey (Sezer et al. 2017; KY082910), Switzerland (Beenken et al. 2020; MN82272), Iran (Arzanlou et al. 2018; MH047243), Italy (Mezzalama et al. 2020; MW045425) and 99% identification from Georgia (Meparishvili et al. 2019; MK157199).
The sequences had a decrease % identification (83%) to Phyllactinia guttata (Accession n° AB080558) (Fig. 3). Pathogenicity was verified on one-year-old vegetation of C. avellana ‘Tonda di Giffoni’, which have been artificially inoculated with a conidial suspension from contaminated leaves (n = 25). Inoculated vegetation have been incubated at 20 to 28°C with 70 to 80% relative humidity.
White mycelium appeared on the higher floor of the leaves at eight to 10 days after inoculation. No signs have been discovered on management vegetation sprayed with sterile water. The fungus current on inoculated leaves was morphologically an identical to the unique isolates from diseased bushes from the sector. E. corylacearum is native to East Asia and was beforehand reported in Japan on wild species of Corylus (Takamatsu et al. 2015; Accession n° LC009928).
The pathogen more than likely unfold into Europe from east to west of Europe (Heluta et al. 2019), through the Caucasus, ranging from Turkey, Azerbaijan, Georgia, and Iran. P. guttata was thought of the one causal agent of powdery mildew on hazelnut in most international locations, together with Romania (Brown 1995). Compared to P. guttata, which typically develops a mycelium on the underside of leaves, E. corylacearum grows with a white mycelium on the higher facet of the leaves.

TNN Conjugated Antibody

C37267 100ul
EUR 397

TNN siRNA

20-abx937676
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNN siRNA

20-abx937677
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

abx027503-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

abx027503-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

20-abx213586
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tenascin-N (TNN) Antibody

20-abx213587
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TNN Antibody, HRP conjugated

1-CSB-PA892498LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNN Antibody, FITC conjugated

1-CSB-PA892498LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNN Antibody, Biotin conjugated

1-CSB-PA892498LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNN. Recognizes TNN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse TNN shRNA Plasmid

20-abx983554
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TNN ELISA Kit

ELA-E6753h 96 Tests
EUR 824

TNN ELISA KIT|Human

EF006402 96 Tests
EUR 689

Human TNN shRNA Plasmid

20-abx961862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal TNN antibody - N-terminal region

AMM08262G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNN - N-terminal region. This antibody is tested and proven to work in the following applications:

TNN ORF Vector (Human) (pORF)

ORF034128 1.0 ug DNA
EUR 405

Tnn ORF Vector (Mouse) (pORF)

ORF060119 1.0 ug DNA
EUR 1572

Tnn ORF Vector (Rat) (pORF)

ORF078047 1.0 ug DNA
EUR 2080

TNN ELISA Kit (Mouse) (OKEH05060)

OKEH05060 96 Wells
EUR 779
Description: Description of target: Isoform 2 inhibits neurite outgrowth and cell migration in hippocampal explants while isoform 1 does not have this affect.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.8 pg/mL

Mouse Tenascin-N (TNN) ELISA Kit

abx520606-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Tnn/ Tenascin-N ELISA Kit

E1507Mo 1 Kit
EUR 632

Human TNN/ Tenascin-N ELISA Kit

E2557Hu 1 Kit
EUR 605

Human TNN(Tenascin-N) ELISA Kit

EH2345 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9UQP3
  • Alias: TNN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Tenascin- N, TNN ELISA KIT

ELI-07573h 96 Tests
EUR 824

Mouse Tenascin- N, Tnn ELISA KIT

ELI-07574m 96 Tests
EUR 865

Human Tenascin-N (TNN) ELISA Kit

abx251701-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

TNN sgRNA CRISPR Lentivector set (Human)

K2419101 3 x 1.0 ug
EUR 339

Human Tenascin-N(TNN) ELISA kit

CSB-EL024008HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenascin-N (TNN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tenascin-N(TNN) ELISA kit

1-CSB-EL024008HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenascin-N(TNN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Tnn sgRNA CRISPR Lentivector set (Mouse)

K3893901 3 x 1.0 ug
EUR 339

Tnn sgRNA CRISPR Lentivector set (Rat)

K6576501 3 x 1.0 ug
EUR 339

Human Tenascin N(TNN)ELISA Kit

QY-E03057 96T
EUR 361

TNN sgRNA CRISPR Lentivector (Human) (Target 1)

K2419102 1.0 ug DNA
EUR 154

TNN sgRNA CRISPR Lentivector (Human) (Target 2)

K2419103 1.0 ug DNA
EUR 154

TNN sgRNA CRISPR Lentivector (Human) (Target 3)

K2419104 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3893902 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3893903 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3893904 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6576502 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6576503 1.0 ug DNA
EUR 154

Tnn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6576504 1.0 ug DNA
EUR 154

ELISA kit for Mouse Tenascin-N (TNN)

KTE70103-48T 48T
EUR 332
  • TNN (Tenascin N) is a Protein Coding gene. Diseases associated with TNN include Dysplastic Nevus Syndrome. Among its related pathways are ECM proteoglycans and ECM-receptor interaction. GO annotations related to this gene include identical protein bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenascin-N (TNN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenascin-N (TNN)

KTE70103-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TNN (Tenascin N) is a Protein Coding gene. Diseases associated with TNN include Dysplastic Nevus Syndrome. Among its related pathways are ECM proteoglycans and ECM-receptor interaction. GO annotations related to this gene include identical protein bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenascin-N (TNN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenascin-N (TNN)

KTE70103-96T 96T
EUR 539
  • TNN (Tenascin N) is a Protein Coding gene. Diseases associated with TNN include Dysplastic Nevus Syndrome. Among its related pathways are ECM proteoglycans and ECM-receptor interaction. GO annotations related to this gene include identical protein bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenascin-N (TNN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TNN Protein Vector (Rat) (pPB-C-His)

PV312186 500 ng
EUR 2632

TNN Protein Vector (Rat) (pPB-N-His)

PV312187 500 ng
EUR 2632

TNN Protein Vector (Rat) (pPM-C-HA)

PV312188 500 ng
EUR 2632

TNN Protein Vector (Rat) (pPM-C-His)

PV312189 500 ng
EUR 2632

TNN Protein Vector (Human) (pPB-C-His)

PV136510 500 ng
EUR 811

TNN Protein Vector (Human) (pPB-N-His)

PV136511 500 ng
EUR 811

TNN Protein Vector (Human) (pPM-C-HA)

PV136512 500 ng
EUR 811

TNN Protein Vector (Human) (pPM-C-His)

PV136513 500 ng
EUR 811

TNN Protein Vector (Mouse) (pPB-C-His)

PV240474 500 ng
EUR 2629

TNN Protein Vector (Mouse) (pPB-N-His)

PV240475 500 ng
EUR 2629

TNN Protein Vector (Mouse) (pPM-C-HA)

PV240476 500 ng
EUR 2629

TNN Protein Vector (Mouse) (pPM-C-His)

PV240477 500 ng
EUR 2629

Tnn 3'UTR GFP Stable Cell Line

TU170915 1.0 ml Ask for price

TNN 3'UTR GFP Stable Cell Line

TU076053 1.0 ml
EUR 1394

Tnn 3'UTR Luciferase Stable Cell Line

TU120915 1.0 ml Ask for price

TNN 3'UTR Luciferase Stable Cell Line

TU026053 1.0 ml
EUR 1394

Tnn 3'UTR Luciferase Stable Cell Line

TU222267 1.0 ml Ask for price

Tnn 3'UTR GFP Stable Cell Line

TU272267 1.0 ml Ask for price

TNN ELISA Kit (Human) : 96 Wells (OKEH01796)

OKEH01796 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Tnn ELISA Kit| Mouse Tenascin-N ELISA Kit

EF016364 96 Tests
EUR 689

TNN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650575 1.0 ug DNA
EUR 2457

TNN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650579 1.0 ug DNA
EUR 2457

TNN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650580 1.0 ug DNA
EUR 2457

TNN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2419105 3 x 1.0 ug
EUR 376

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3893905 3 x 1.0 ug
EUR 376

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6576505 3 x 1.0 ug
EUR 376

TNN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2419106 1.0 ug DNA
EUR 167

TNN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2419107 1.0 ug DNA
EUR 167

TNN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2419108 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3893906 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3893907 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3893908 1.0 ug DNA
EUR 167

TNN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV650576 1.0 ug DNA
EUR 2457

TNN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV650577 1.0 ug DNA
EUR 2515

TNN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV650578 1.0 ug DNA
EUR 2515

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6576506 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6576507 1.0 ug DNA
EUR 167

Tnn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6576508 1.0 ug DNA
EUR 167

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug